WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: seam cells; Primary Identifier  Expr6761
Remark  Strain: BC14683 Reporter Gene  [T25D3.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGTGGGAAAACGAATTTTTGAA] 3' and primer B 5' [CACTTGTTGGCTGATTCCATTA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00020798 T25D3.4 T25D3.4 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023