WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: hypodermis; Nervous System; neurons along body; Primary Identifier  Expr6721
Remark  Also expressed in (comments from author) : Note: primers are not unique and produce 2 products.Mosaic population. The cell body of the neuron is in the tail, and does not express in all larvae.Interesting localization pattern, possibly subcellular but seems non-nuclear Strain: BC12016 Reporter Gene  [T20D4.18::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATAATCCATCAAAGGGTCCG] 3' and primer B 5' [GGCAATGCACTTGATAGGAAA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses. neuron neurone WBbt:0003679

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00020623 srab-21 T20D4.18 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023