WormMine: ExpressionPattern Expr6701

• Pattern: Adult Expression: Nervous System; amphid socket cells; tail neurons; unidentified cells in head; unidentified cells in body ; Larval Expression: Nervous System; amphid socket cells; tail neurons; unidentified cells in head; unidentified cells in body
• Primary Identifier: Expr6701
• Remark: Also expressed in (comments from author) : Unidentified cells in head possibly amphid cells, or amphid sheath cells. Strain: BC12852
• Reporter Gene: [grl-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAACTTACCACACCTGCACA] 3' and primer B 5' [AAGTGCAGTTAGGATACTTGGTA] 3'.

6 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
Amphid socket cell, left	AMsoL	lineage name: ABplpaapapa	WBbt:0003931
Amphid socket cell, right	AMsoR	lineage name: ABprpaapapa	WBbt:0003929
anterior-most body region containing the pharynx.	head		WBbt:0005739
region of the body by which tissues, cells or cell parts are classified	body region		WBbt:0005738

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00001711	grl-2	T16G1.8	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023