WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: excretory cell; Larval Expression: excretory cell; Primary Identifier  Expr6113
Remark  Strain: BC11730 Reporter Gene  [F48E8.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCATTCCCAAAACCTATTCAA] 3' and primer B 5' [GAAGCACAGAAGCGATAACTGTAA] 3'.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00018610 F48E8.3 F48E8.3 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023