WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: spermatheca; Larval Expression: developing spermatheca; Primary Identifier  Expr6198
Remark  Strain: BC15761 Reporter Gene  [F55B11.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGAAAATGCTCTGAAATTAAACA] 3' and primer B 5' [ATATTTCAGGATTGGGATTTGGT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization. spermatheca   WBbt:0005319

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00010085 F55B11.3 F55B11.3 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023