WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Nervous System; nerve ring; head neurons; Larval Expression: hypodermis; Nervous System; nerve ring; head neurons; Primary Identifier  Expr6390
Remark  Strain: BC13600 Reporter Gene  [nas-11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCCAATTCTATCTCGTATGTTCA] 3' and primer B 5' [TGCTGGATTAGTGTTAAATGCAA] 3'.

4 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003530 nas-11 K11G12.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023