WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: hypodermis; Nervous System; tail neurons; phasmids; Primary Identifier  Expr6350
Remark  Also expressed in (comments from author) : No comments. Strain: BC11779 Reporter Gene  [dao-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGATATGAAATCCCATTGTCCA] 3' and primer B 5' [ATCTCCGCGACGATTCTAAA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

4 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
neuron of phasmid sensillum phasmid neuron   WBbt:0006753

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000929 dao-3 K07E3.3 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023