WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Nervous System; head neurons; pharyngeal neurons; Larval Expression: Nervous System; head neurons; pharyngeal neurons; Primary Identifier  Expr6311
Remark  Also expressed in (comments from author) : Expresses in NSM neuron(s) Strain: BC10951 Reporter Gene  [ceh-28::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATGGGTAGCAACAGATGTGAA] 3' and primer B 5' [TGCGTAGATTGGATTGGGA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neuron of the pharyngeal nervous system. pharyngeal neuron   WBbt:0005439

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000450 ceh-28 K03A11.3 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023