WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: unidentified cells in head; Primary Identifier  Expr6265
Remark  Also expressed in (comments from author) : unidentified: one cell in head Strain: BC10206 Reporter Gene  [ser-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAACTGACTGTTCTATTT] 3' and primer B 5' [AGGAGTGCACCTCTGAAACAA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
anterior-most body region containing the pharynx. head   WBbt:0005739

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00004776 ser-1 F59C12.2 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041