WormMine: Gene WBGene00004776

• WormBase Gene ID: WBGene00004776
• Gene Name: ser-1
• Sequence Name: F59C12.2
• Brief Description: ser-1 encodes a putative ortholog of mammalian 5-HT2 metabotropicserotonin receptors; SER-1 is required in both vulval muscle and neuronsfor the stimulation of egg-laying by serotonin (5-HT), but is completelydispensable for stimulation by the uptake inhibitor fluoxetine, andmostly dispensable for stimulation by the tricyclic antidepressantimipramine; SER-1 and SER-7 are redundantly required for normalegg-laying; SER-1 is required for normal turning during male mating, andser-1 mutants show reduced male tail curling in exogenous 5-HT, butser-1 males retain mating ability in the laboratory; SER-1 is weaklyrequired for pharyngeal pumping; SER-1 is expressed in diverse neurons(head, nerve ring, vulval, ventral cord motoneurons, tail, and manyothers), in diverse muscles (pharyngeal, vulval, and male-specificdiagonal), and in uterine cells; stimulation of heterologously expressedSER-1 induces a rise in free intracellular calcium; SER-1 has lowaffinity for 5-HT, and a mixture of pharmacological similarities tomammalian 5-HT1 and 5-HT2 receptors; SER-1 is stimulated byalpha-methyl-5HT, and probably antagonized by methiotheptin; SER-1 iscoexpressed with MPZ-1, has a PDZ binding motif (ETFL) that aids itssignalling, and binds PDZ domain 10 of MPZ-1 in vitro; SER-1'sstimulation of egg-laying is impeded by mpz-1(RNAi), if and only ifSER-1's ETFL motif is intact; mod-1;ser-1 double mutants subtly overbendtheir bodies while moving backward.
• Organism: Caenorhabditis elegans
• Automated Description: Enables G protein-coupled serotonin receptor activity and serotonin binding activity. Involved in several processes, including reproductive behavior; response to heat; and signal transduction. Located in plasma membrane. Expressed in several structures, including egg-laying apparatus; intestine; neurons; pharyngeal muscle cell; and somatic nervous system. Human ortholog(s) of this gene implicated in several diseases, including alcohol dependence; alcoholic psychosis; and metabolic dysfunction-associated steatotic liver disease (multiple). Is an ortholog of human HTR2A (5-hydroxytryptamine receptor 2A) and HTR2B (5-hydroxytryptamine receptor 2B).
• Biotype: SO:0001217
• Genetic Position: X :24.0554 ±0.000961
• Length (nt): 7880

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004776

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F59C12.2a.1	F59C12.2a.1	2214	X: 16579745-16587624
Transcript:F59C12.2b.1	F59C12.2b.1	1908	X: 16582006-16587462

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F59C12.2a	F59C12.2a	2052	X: 16579745-16579808
CDS:F59C12.2b	F59C12.2b	1908	X: 16582006-16582219

13 RNAi Result

• WBRNAi00065823
• WBRNAi00049157
• WBRNAi00075433
• WBRNAi00016086
• WBRNAi00027764
• WBRNAi00069710
• WBRNAi00117762
• WBRNAi00069694
• WBRNAi00069702
• WBRNAi00069718
• WBRNAi00069726
• WBRNAi00103053
• WBRNAi00078845

103 Allele

• gk964260
• gk962707
• gk963810
• gk963581
• WBVar01929489
• gk306080
• gk306079
• gk306078
• gk306086
• gk306085
• gk306084
• gk306083
• gk306082
• gk306081
• gk306089
• gk306088
• gk306087
• gk909935
• gk913952
• gk860342
• gk370730
• gk485860
• gk465086
• gk522627
• gk867093
• gk360491
• gk692160
• gk534958
• gk863084
• gk710885

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004776
• Start: 16579745
• End: 16587624
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_16587625..16590394
• Length (nt): 2770
• Chromosome Location: X: 16587625-16590394
• Organism: Caenorhabditis elegans

90 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Coexpression clique No. 60, 176662_at-Y53F4B.16, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:176662_at-Y53F4B.16
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite npr-8(ok1439) animals grown at 25C, comparing to in N2 animals.	CuffDiff, fold change > 2.	WBPaper00065096:npr-8(ok1439)_upregulated_Day10_25C
	Transcripts that showed significantly decreased expression in npr-8(ok1439) animals with 24 hour exposure to P. aeruginosa PA14, comparing to N2 animals with 24 hour exposure to P. aeruginosa PA14.	DESeq2, fold change > 1.5, FDR < 0.05.	WBPaper00058948:npr-8(ok1439)_downregulated_PA14
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L2-larva_expressed
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:mep-1(ne4629)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in npr-15(tm12539) comparing to in N2 at L4 larva stage.	Fold change > 2, FDR < 0.05.	WBPaper00066608:npr-15(tm12539)_upregulated
	Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:eat-2(ad1116)_downregulated
	Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage.	DESeq v1.6.3. Fold change > 1.5.	WBPaper00050370:dpy-21(e428)_L3_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Rifampicin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_downregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult

16 Expression Patterns

• Primary Identifier: Expr4332
• Pattern: Expressed in head neurons.

• Primary Identifier: Expr4244
• Pattern: ser-1::gfp expression was observed in the pharyngeal muscles. In addition, ser-1::gfp expression was observed in the vulval muscles, as well as in many neurons. ser-1::gfp is not detectable in HSN or VC.

• Primary Identifier: Expr6265
• Remark: Also expressed in (comments from author) : unidentified: one cell in head Strain: BC10206
• Reporter Gene: [ser-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAACTGACTGTTCTATTT] 3' and primer B 5' [AGGAGTGCACCTCTGAAACAA] 3'.
• Pattern: Adult Expression: unidentified cells in head

• Primary Identifier: Expr7825
• Remark: Picture: Fig. 7.
• Pattern: The most predominant fluorescence was detected in the head ganglia and the ring neuropile. Among the head neurons labeled, strong and consistent fluorescence was detected in the bilaterally symmetrical pair of RIA interneurons and, less strongly but also consistently, in the bilaterally symmetrical RIC neurons. In addition, inconsistent staining of URY was detected. Outside the head region consistent labeling of the tail neuron, PVT, and possibly DVC was detected, although this latter neuron could not be positively identified. Authors could not detect any consistent expression of our ser-1::GFP construct in muscle either of the body wall, vulva or pharynx.

• Primary Identifier: Expr12907
• Pattern: In addition to RIA localization, ser-1 shows axonal localization in several neuronal cell types, such as another head interneuron, AVE, and a bipolar sensory neuron, ASH.

• Primary Identifier: Expr1032368
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr8282
• Remark: Animals expressing a Pser-1::gfp transgene containing a 3.4 kB upstream promoter region failed to express gfp in the vulval muscles but did express gfp in many of the other cells seen with the 8 kB promoter reporter construct. Picture: Figure 2B, 2C, 2D.
• Pattern: In addition to the previously reported expression in pharyngeal muscle and neuronal processes in the nerve ring, authors observed, beginning at the L1 larval stage, expression of gfp in neurons in the head, neurons in the tail (including PVT and PVQ), ventral cord motorneurons, and in adults in vulval muscle and uterine cells. Authors also observed faint expression of gfp in the posterior intestine. Authors did not observe expression in the HSNs or VC neurons.

• Primary Identifier: Expr3962
• Pattern: As predicted from expression driven by the individual promoters, only 3 pairs of ring motorneurons (RMHs, RMFs, RMDs) expressed both ser-1::yfp and mpz-1::cfp. Unfortunately, attempts to colocalize the full length proteins were unsuccessful using this approach as SER-1::YFP and SER-1::CFP aggregated significantly when expressed in vulval muscle.

• Primary Identifier: Expr2711
• Pattern: ser-1::gfp is expressed in most pharyngeal muscles. ser-1::gfp was not obviously detectable in pharyngeal neurons, but it is possible that weak expression may be obscured by the strong pharyngeal muscle gfp expression. Faint fluorescence can be observed surrounding the isthmus of the pharynx and may be ascribed to the neuropil of the nerve ring.

• Primary Identifier: Expr1152900
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2015746
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr12908
• Subcellular Localization: In the intestine, wild-type SER-1 is exclusively localized to the basolateral surface of the plasma membrane and some intracellular puncta.

• Primary Identifier: Expr12903
• Subcellular Localization: SER-1 is localized stringently to the distal axonal segment.

• Primary Identifier: Expr1027967
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1412
• Remark: Original chronogram file: chronogram.292.xml
• Reporter Gene: [F59C12.2:gfp] transcriptional fusion.

• Primary Identifier: Expr2033979
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

28 GO Annotation

1 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004776
• Start: 16579745
• End: 16587624
• Strand: 1

28 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 7880

1 Sequence Ontology Term

• Name: gene

11 Strains

• WBStrain00055579
• WBStrain00055576
• WBStrain00055575
• WBStrain00055572
• WBStrain00055583
• WBStrain00055581
• WBStrain00055580
• WBStrain00055060
• WBStrain00005591
• WBStrain00001356
• WBStrain00005588

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_16579521..16579744
• Length (nt): 224
• Chromosome Location: X: 16579521-16579744
• Organism: Caenorhabditis elegans