WormMine: ExpressionPattern Expr7011

• Pattern: Larval Expression: Nervous System; head neurons; neurons along body
• Primary Identifier: Expr7011
• Remark: Also expressed in (comments from author) : No comments. Strain: BC13697
• Reporter Gene: [smg-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATCAAACATTTTAGAGTTTTCCC] 3' and primer B 5' [GAAGAAAAGTGCGTTTTTGAGG] 3'.

3 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses.	neuron	neurone	WBbt:0003679

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00004880	smg-2	Y48G8AL.6	Caenorhabditis elegans

1 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023