WormMine: ExpressionPattern Expr7201

• Pattern: Adult Expression: Nervous System; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail
• Primary Identifier: Expr7201
• Remark: Also expressed in (comments from author) : incomplete. Will be updated. Strain: BC12009
• Reporter Gene: [ZK265.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAAAGGAGACAAACGGAACAC] 3' and primer B 5' [CGGTAGCATTGATCATAGTTGATT] 3'.

6 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses.	neuron	neurone	WBbt:0003679
posterior region, from rectum to the end	tail		WBbt:0005741
anterior-most body region containing the pharynx.	head		WBbt:0005739

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00013957	sre-23	ZK265.5	Caenorhabditis elegans

1 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041