WormMine: ExpressionPattern Expr7053

• Pattern: Adult Expression: unidentified cells in body ; Larval Expression: pharynx; developing uterus; hypodermis; Nervous System; head neurons
• Primary Identifier: Expr7053
• Remark: Also expressed in (comments from author) : Observation in Apr vs Oct 2005: Apr is posted and was low intensity GFP. In Oct, nothing but the proximal tip of the gonad expressed GFP. Strain: BC14240
• Reporter Gene: [Y54G2A.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCGATGGTTTTGGAAAGAGTT] 3' and primer B 5' [ATCGATCAGTTGGGATTTATGG] 3'.

6 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
The organ in which the eggs are developed and protected until laid.	uterus		WBbt:0006760
region of the body by which tissues, cells or cell parts are classified	body region		WBbt:0005738

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00003008	lin-22	Y54G2A.1	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023