WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: pharynx; hypodermis; seam cells; Primary Identifier  Expr7174
Remark  Also expressed in (comments from author) : Analysis notes were lost. Have extroplated from the images.Adult and Embryo incomplete. To be updated. Strain: BC14674 Reporter Gene  [ccr-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTCAGTCAACATACGGTCG] 3' and primer B 5' [ACCATTTAAAATACCGGTCATCC] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000376 ccr-4 ZC518.3 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023