WormMine: ExpressionPattern Expr50

• Pattern: b-galactosidase expression in areas of all the major ganglia (lateral, ventral, retrovesicular, pre-anal and dorso-rectal), along the ventral nerve cord, occasionally in the spermathecal valves and in the vulva. Expression appears to be nuclear-localized, although cell bodies and neural processes in the ventral nerve cord also show staining. The pattern is first visualized as a stripe of staining following the curve of the elongating embryo, possibly corresponding to the embryonic ventral nerve cord which consists of the DA, DB and DD motorneurones
• Primary Identifier: Expr50
• Remark: Fusion junction ...AGCTCTCCAACGATGTACGAGAGAAGGATGCTGGGAAGGTCGTGGAAGTGTTGAAAGTCACGACCACGG TCAATAGATTATGTAGAGGATTCCCTACGTCACGAGTATCTAGATGGATTGCAAGGGGAAGAGGACGCACTG GCAAAGATC/lacZ. Legacy Data: Author "Arnold JM" "Krupa AP" "Hope IA". Date 1992-01. Young and Hope (1993). Dev. Dynam. 196:124-132 = [cgc1752]

8 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
female genital.	vulva		WBbt:0006748
A valve tissue that connects the spermatheca and the uterus of a hermaphrodite gonad.	spermathecal-uterine junction	sp-ut valve	WBbt:0006756
Ganglion that lies at the anterior limit of the ventral nerve cord, near the ventral ganglion and nerve ring in the head posterior to the excretory pore. It is open and continuous with the region containing the motoneurons of the ventral cord. In the early L1 this ganglion holds 12 neuron cell bodies plus one neuroblast (Sulston and Horvitz, 1977; White et al., 1986). In the adult animal, the ganglion holds 20 neuron cell bodies.	retrovesicular ganglion		WBbt:0005656
the ganglion that lies above and behind the rectum in the tail, in close continuity with the anal hypodermal ridge. It contains 3 neuron cell bodies (DVA, DVB and DVC) that send their neuronal processes into the ventral nerve cord via dorso-rectal commissures that encircle the anus. The ganglion contains no local neuropil in the hermaphrodite. In the adult male tail, this ganglion gains additional neurons and some local neuropil.	dorso-rectal ganglion		WBbt:0005212
ganglion anterior to the anus.	preanal ganglion		WBbt:0005448
The left and right lateral ganglia lie beside the nerve ring in the head. They each contain about (30) neuron cell bodies and send their neuronal processes into the ring at its posterior margin either laterally or ventrally via the amphid commissures and ventral ganglion, but form no local neuropil separate from the nerve ring. The lateral ganglia are in close contact with the lateral hypodermal cords.	lateral ganglion	lateral ganglia	WBbt:0005105
ganglion lies beside the nerve ring in the head, just anterior of the retrovesicular ganglion. It contains about 20 interneuron and motorneuron cell bodies that all send their neuronal processes into the ring. The cell bodies are divided into two groups by the intrusion of the excretory duct and canal. The cells are bounded by a basal lamina which physically separates them from the lateral ganglion even though they are adjacent to one another.	ventral ganglion	ventral ganglia	WBbt:0005298

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00003980	pes-7	F09C3.1	Caenorhabditis elegans

0 Life Stages