WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Primary Identifier  Expr7019 Remark  Also expressed in (comments from author) : Functional GFP::protein fusion.nuclear expression (his-72). Not in oocytes. Strain: BC12421
Reporter Gene  [his-72::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAAATAACACGACAAGAAACG] 3' and primer B 5' [agcacgttctccgcggatgcgt] 3'.

0 Anatomy Terms

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001946 his-72 Y49E10.6 Caenorhabditis elegans

0 Life Stages