WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; vulva other; Primary Identifier  Expr7041
Remark  Strain: BC13253 Reporter Gene  [Y54E2A.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTCGGACATTTTTCCACA] 3' and primer B 5' [ATCGATTTCCAGTTGTCGTTG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

2 Anatomy Terms

Definition Name Synonym Primary Identifier
female genital. vulva   WBbt:0006748
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00013189 Y54E2A.4 Y54E2A.4 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041