WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: amphid socket cells; Larval Expression: amphid socket cells; Primary Identifier  Expr7134
Remark  Also expressed in (comments from author) : detecting a single head cell.. likely an amphid socket cell. Strain: DM13283 Reporter Gene  [grd-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATAACAATCTCGCTATCCTCCA] 3' and primer B 5' [AAGACGGGCGGTTCTTACTTA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

2 Anatomy Terms

Definition Name Synonym Primary Identifier
Amphid socket cell, left AMsoL lineage name: ABplpaapapa WBbt:0003931
Amphid socket cell, right AMsoR lineage name: ABprpaapapa WBbt:0003929

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001704 grd-15 Y87G2A.15 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023