WormMine: ExpressionPattern Expr9061

• Pattern: In animals that carried the pst-1ab(fl)::egfp, pst-1c(fl)::egfp, and Ppst-1bc::egfp vectors, GFP fluorescence was specifically observed in seam cells and amphid sheath cells during embryonic and larval development. GFP expression was also detected in the hypodermis of L4 transgenic animals that carried pst-1ab(fl)::egfp and pst-1c(fl)::egfp. No vulval expression was observed in these transgenic worms.
• Primary Identifier: Expr9061
• Remark: In transgenic animals that carried Ppst-1a::egfp (translational fusion, forward primer 5- ACTGTTTCGTGGCAAGATCA 3, reverse primer 5- CATGATTGCTCTGAATACCTGG 3), GFP fluorescence was observed in almost all cells throughout development, except germ cells, where extrachromosomal transgenes are generally silenced . The pst-1ab(fl)::egfp and pst-1c(fl)::egfp constructs included the entire sequence of pst-1a, but Ppst-1a::egfp only carried the 5 promoter region of pst-1a; thus, broad expression of Ppst-1a::egfp might be induced due to the absence of a regulatory region for transgene expression. Additionally, the expression pattern induced by a promoter of the M03F8.3 gene, a gene immediately upstream of pst-1, was similar to that induced by the pst-1a promoter (sEx10297). Expression data from a genome-wide in situ hybridization analysis indicated that pst-1 mRNA was specifically expressed in lateral seam cells. Picture: Fig 6A to 6D.

4 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail	seam cell	lateral hypodermis	WBbt:0005753
Embryonic cell of pedigree ABplaapaapp, amphid sheath cell, left.	AMshL	ABplaapaapp	WBbt:0003935
Embryonic cell of pedigree ABpraapaapp, amphid sheath cell, right.	AMshR	ABpraapaapp	WBbt:0003933

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00004206	pst-1	M03F8.2	Caenorhabditis elegans

0 Life Stages