|
|
|
Expr4684
|
GFP expression was detected at most developmental stages, with the spatial expression depending on the developmental stage of the animal. Neuronal expression of hlh-29 was detected in larvae and adults in both amphid and phasmid sockets, in the ALA and PVT neurons, in the chemosensory and mechanosensory neurons, ASI, ASK, PHA, and PQR, and in neurons of the anterior pharyngeal bulb. Weaker expression was also detected in the ASG chemosensory neurons in some transgenic lines. L1 animals show strong expression of hlh-29 in intestinal cells, and weaker expression in the rectal glands and the pharyngeal muscle cell PM1. By L3 stage, intestinal expression of the hlh-29::GFP is limited to the posterior intestinal cells, and PM1 expression is no longer detected. Expression is also detected in the ventral posterior coelomocytes in the later L3-stage larvae, and in the spermatheca and vulval muscles of L4 and adult animals. |
|
|
|
|
Expr4395
|
The pps-1p::EGFP reporter is widely but tissue-specifically expressed in somatic cells. pps-1p::EGFP is strongly expressed in seam cells, gland cells, and neuronal support cells (amphid sheath cells) throughout development. Relatively weak expression was also detected in the hypodermis and the phasmid support cells during larval development. Additionally, weak expression was observed in the intestine at the adult stage. No signal was found in the neurons and muscles. |
|
|
|
|
Expr4396
|
The tissues expressing pps-1(FL)::EGFP and the timing of its expression were almost identical to those expressing pps-1p::EGFP. See Expr4395 |
pps-1(FL)::EGFP is dominantly localized in nuclei of all expressing cells. |
|
|
|
Expr4463
|
Expressed in sheath cell of amphids. |
|
|
Picture: Fig 3. |
|
Expr8673
|
Expression in the alimentary canal: Strong and consistent expression in anterior arcades, posterior arcades, M1, B cell. Weak or rare expression in intestine. Expression in the nervous system: Amsh, CEPsh, CEPso, ILso, OLso, Phso, DVC, MI. Expression in the reproductive system: In adult stage, expressed in gonad sheath, uterus, vulva(low), spermatheca, Sp-ut valve. In developing larva stage, expressed in uterus, vulva, spermatheca, Sp-ut valve. inx-5 first appears in the developing hypodermis at bean stage and then in the excretory cell at three-fold stage. |
|
|
All of the reporter constructs produced the same cell-specific expression pattern as transgenes. |
|
Expr1438
|
The reporter transgenes express ubiquitously in the early embryo starting at about the 100 cell stage during gastrulation. In late embryogenesis and posthatching, expression is more limited. Strongest expression is observed in migrating cells and growing neurons as these cells undergo movements on the epidermis. At hatching, the reporters express in many neurons throughout the animal, in several cells of the pharynx including some pharyngeal neurons, in the elongated processes of the excretory cells, in the amphid and phasmid sheath and socket cells, in the tail hypodermis, and at later stages in intestine, muscles, vulva, and somatic gonad including the gonad sheath and hermaphrodite distal tip cells. The neurons expressing unc-73 include the PLM, ALM, PDE, HSN, CAN, PHC, and PVN neurons and the ventral cord motorneurons. Expression in the HSNs is absent in early larval stages, but begins late in the second larval stage (L2), precisely when axon outgrowth is initiated from the HSN cell bodies. The Q neuroblasts, Pn neuroectoblasts, sex myoblasts (SMs), and canal associated neurons (CANs) express unc-73 reporters. The left and right Q cells begin to express the GFP reporter as they initiate their migrations along the longitudinal axis of the epidermis during the early first larval (L1) stage, and expression in these cells continues beyond the completion of their first division. The unc-73 reporters express in the Pn cells just before this second phase of movemen. The distal tip cells also express the unc-73/reporters during their migration. |
|
|
Picture: Figure 3A. |
|
Expr8537
|
When fused to a GFP reporter, the 21-kb region upstream of nsy-7 drove expression in numerous cell types including gut, the amphid sheath glial cells, and head and tail neurons including AWC, ASE, and ASH. In adult animals, nsy-7::GFP was asymmetrically expressed in one AWC neuron. The nsy-7-expressing neuron was identified by crossing a line expressing nsy-7::GFP with a line expressing an srsx-3::mCherry (AWCOFF) reporter or a str-2::dsRed2 (AWCON) reporter. nsy-7 was consistently expressed in the same cell as str-2 (145/158 animals), and contralateral to the cell expressing srsx-3 (99/99 animals). Therefore, nsy-7 appears to be expressed in AWCON but not AWCOFF. |
|
|
Picture: Fig 3. |
|
Expr8846
|
Neuronal Expression: AVA, I1, I4, M4, NSM. Non-neuronal Expression: amphid sheath cells. |
|
|
Reference: personal communication from Oliver Hobert 2002-12-07. |
|
Expr1759
|
Neuronal expression in: strong, consistent AVAL/R; 2 strong pharyngeal neurons; amphid sheath; weak inconsistent PVT. Non-neuronal expression in: intestine |
|
|
Picture: N.A. |
|
Expr8680
|
Expression in the alimentary canal: Strong and consistent expression in M2, rectal epithelial cells. Weak or rare expression in anterior arcades, posterior arcades. Expression in the nervous system: Amsh, CEPso, ILso, OLso, PDEso, AVH (early larva), AVJ (early larva), AVK, CAN, IL1 (early larva), PDE, PVD, SIB (early larva), URB, VAn, VBn, M2. Expression in the reproductive system: In adult stage, expressed in vulva, spermatheca, sperm(spermatocytes, spermatids). In developing larva stage, expressed in vulva. inx-12 expressionstarts in seam precursors around 1.5-fold stage, followed by expression in arcade cells by 2-fold and head neurons by 3-fold stage. inx-12 is expressed in the hypodermal cells of the animal in postembryonic stages. |
|
|
Other Strain: OH14338 |
|
Expr14087
|
ADL, other head neurons in anterior and ventral ganglion (much dimmer), PHA, PHB, vulva, anterior sheath/socket cells (Amsh/Amso?), males - expression in rays |
|
|
Picture: Fig. 6. ant-1.4 = T01B11.4 |
|
Expr8111
|
The ANT-1.4::GFP is expressed in a pair of neurons that sends a ciliary process to the tip of the head. Occasionally, green fluorescent protein (GFP) is also detected in the amphid socket and sheath cells. Expression is detected in one neuron located in the nerve cord identified as the VA11 motoneuron and occasionally in the rectal gland cell and at a lower level in an other motoneuron. The GFP signal is observed in the ventral nerve cord in neural processes that go to the nerve ring. The signal is also seen in a few body-wall muscle cells and the vulval muscle cells. |
|
|
|
|
Expr3510
|
Pdaf-6GFP was expressed in the amphid sheath glia. Expression was also seen in amphid socket cells, the phasmid sensory organ sheath and socket cells, cells of the excretory system (the excretory canal, duct, pore, and gland cells), the vulval E and F cells, the K, K', F, and U rectal epithelial cells, and less frequently in posterior intestinal cells. |
|
|
|
|
Expr3511
|
|
In the amphid, DAF-6::GFP fusion protein expression usually persisted only up to the L1 larval stage, and the protein localized to the region of the amphid channel formed by the sheath and socket cells. DAF-6::GFP also localized to the luminal surfaces of tubes generated by other cells expressing daf-6. As in the amphid, expression in the phasmid sheath and socket cells usually did not persist beyond the L1 larval stage. Expression in vulval cells was usually restricted to the L4 larval stage, after the cells were generated and during or shortly after the vulval lumen was generated. Expression in the rectum and excretory system was observed throughout embryogenesis and larval development, but usually not during adulthood. DAF-6::GFP protein was detected in punctate structures within the cytoplasm of expressing cells. This localization was best seen in the vulva and in the excretory canal cell. Thus, DAF-6 may localize to vesicles as well. |
|
|
|
Expr9934
|
The ztf-16 promoter::gfp construct including a region -4637 to -2536 of the ztf-16 promoter relative to the +1 translation start site gives strong, specific expression in AMsh and PHsh glia, AMso and PHso socket glia, and in an unidentified pair of neurons in the head. By contrast, a 2.5 kb region immediately adjacent to the ztf-16 start codon is expressed in hypodermal and other cell types, but not in glia (data not shown). |
Localization of a ZTF-16::GFP fusion protein to the nucleus of the AMsh glia when expressed under a glia-specific promoter (nsEx1347). |
|
Picture: N.A. |
|
Expr8927
|
Expressed in excretory cell, AMsh and PHsh. |
|
|
Picture: N.A. |
|
Expr8930
|
Expressed in all intestinal cells(weak), major hypodermis, vulva epithelium, rectal epithelium, AMsh, IL/OLso and excretory duct cell. |
|
|
In transgenic animals that carried Ppst-1a::egfp (translational fusion, forward primer 5- ACTGTTTCGTGGCAAGATCA 3, reverse primer 5- CATGATTGCTCTGAATACCTGG 3), GFP fluorescence was observed in almost all cells throughout development, except germ cells, where extrachromosomal transgenes are generally silenced . The pst-1ab(fl)::egfp and pst-1c(fl)::egfp constructs included the entire sequence of pst-1a, but Ppst-1a::egfp only carried the 5 promoter region of pst-1a; thus, broad expression of Ppst-1a::egfp might be induced due to the absence of a regulatory region for transgene expression. Additionally, the expression pattern induced by a promoter of the M03F8.3 gene, a gene immediately upstream of pst-1, was similar to that induced by the pst-1a promoter (sEx10297). Expression data from a genome-wide in situ hybridization analysis indicated that pst-1 mRNA was specifically expressed in lateral seam cells. Picture: Fig 6A to 6D. |
|
Expr9061
|
In animals that carried the pst-1ab(fl)::egfp, pst-1c(fl)::egfp, and Ppst-1bc::egfp vectors, GFP fluorescence was specifically observed in seam cells and amphid sheath cells during embryonic and larval development. GFP expression was also detected in the hypodermis of L4 transgenic animals that carried pst-1ab(fl)::egfp and pst-1c(fl)::egfp. No vulval expression was observed in these transgenic worms. |
|
|
Picture: Figure 3A to 3H. |
|
Expr8358
|
Expressed in the amphid sheath cells which were labelled with sheath cell-specific marker VAP-1::RFP. |
|
|
Picture: Figure S2. |
|
Expr8359
|
T02B11.3 is expressed in C. elegans amphid sheath cells. |
|
|
Picture: N.A. |
|
Expr8681
|
Arcade cells are seen to express inx-13 at high levels starting around two-fold stage continuing throughout development and adulthood. inx-13 is expressed in the hypodermal cells of the animal in postembryonic stages. Expression in the alimentary canal: Strong and consistent expression in M1, M2. Weak or rare expression in intestine, rectal epithelial cells. Expression in the nervous system: Amsh, CEPsh, CEPso, ILsh, ILso, OLsh, OLso, Phsh, CAN, DVA, DVB, DVC, LUA, PHA, PHB, PLN, PVC, PVQ, PVR, M1, M2. Expression in the reproductive system: In adult stage, expressed in spermatheca, sp-ut valve. |
|
|
|
|
Expr1426
|
CED-7 was widely expressed in embryos and was localized to the plasma membrane. In larvae and adults, CED-7 expression appeared restricted to specific cells. Specifically, CED-7 was detected in the amphid sheath cells, the pharyngeal-intestinal valve, and the phasmid sheath cells. CED-7 expression was also detected in both germline precursors and germline, except sperm in larvae and adults, respectively. |
CED-7 was localized to the plasma membrane |
|
Protein_Description: ICB3 antigen. |
|
Expr2785
|
Antigen expressed in supporting cells (amphid sheath cell and a component of the phasmids) and intestine. |
|
|
See Expr593, and Expr594 for expression patterns for the same locus. This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope). |
|
Expr595
|
Earliest staining against antipeptide antibodies was in embryo 430 mins after first cleavage that had elongated about 1.5-fold. Staining persists throughout development in the sheath cells of amphids and phasmids. At L2, the 16 sheath cells of anterior sensilla localized at the tip of the head area are detected by antibody against extracellular domains of ADM-1. Antibody against peptides bp2 and bp3 show syncytial hypodermis, vulva and mature sperm. |
Staining in sperm, between embryonic cells, in the sheath cells and in the hypodermis appear to be associated with intracellular membranes and the plasma membrane. |
|
|
|
Expr2796
|
L2 stage worms showed GFP fluorescence in the ventral hypodermis. Expression of Ce-dab-1 within the VPCs and their descendants continued through vulval development, and became restricted to the descendants of P5.p and P7.p by mid-L4. Ce-dab-1 was also expressed in the anchor cell (AC), sheath cells surrounding the amphid neurons in the head, the gut, and several unidentified cells in the anus and uterus of L3-adult animals. However, no Ce-dab-1 expression was detectable in the SMs. |
|
|
Picture: N.A. |
|
Expr8912
|
Expressed in anterior intestine (most cells), major hypodermis, CEPsh, AMsh, PHsh. |
|
|
Picture: N.A. |
|
Expr8923
|
Expressed in all intestinal cells (weak), major hypodermis, uterus, vulva epithelium, AMsh, arcade cells and PHsh. |
|
|
|
|
Expr12665
|
clh-1 is expressed in the AMsh cell body and processes. In addition to AMsh glia, expression of GFP was observed in other cells in the head, including 3 sets of neurons located posterior to the C. elegans nerve ring, as was previously reported (Nehrke et al., 2000). |
|