WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: excretory cell; Larval Expression: arcade cells; excretory cell; Primary Identifier  Expr7216
Remark  Strain: BC12924 Reporter Gene  [tag-22::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAACACATTTTATGTCTACAGGA] 3' and primer B 5' [CATAGTCCTCCGAGATTTCAA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

2 Anatomy Terms

Definition Name Synonym Primary Identifier
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812
Interfacial (hypodermal) cells which connect the hypodermal epithelium of the lips to the pharyngeal epithelium, firmly binding the inner tissue (the pharynx) to the outer bodywall (the hypodermis). arcade cell   WBbt:0005793

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00006410 nck-1 ZK470.5 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023