WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: hypodermis; Primary Identifier  Expr7146
Remark  Also expressed in (comments from author) : No comments. Strain: BC16205 Reporter Gene  [str-168::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAGACAATAATCCCGATGG] 3' and primer B 5' [TCCCTTTCAGAGATTTGAGGA] 3'.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00006212 str-168 Y9C9A.6 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023