WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; vulval muscle; Primary Identifier  Expr7129
Remark  Strain: BC12236 Reporter Gene  [Y76A2B.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCCCAGCTGAAAAACTTGTTA] 3' and primer B 5' [TCTGTTCTCTGTCCCGCTTT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

2 Anatomy Terms

Definition Name Synonym Primary Identifier
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00013578 scav-2 Y76A2B.6 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041