WormMine: AnatomyTerm WBbt:0003681

• Definition: the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.
• Name: pharynx
• Primary Identifier: WBbt:0003681
• Synonym: esophagus

4 Children

Definition	Name	Synonym	Primary Identifier
	pharyngeal cell		WBbt:0005460
the space in the center of pharynx which allows the passage of food.	pharyngeal lumen		WBbt:0005790
The pharyngeal nervous system is composed of 20 pharyngeal neurons which lie completely within the pharynx.	pharyngeal nervous system		WBbt:0005440
	pharyngeal segment		WBbt:0005789

12 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with at least 2-fold greater expression in par-1 emrbyos (with excess pharyngeal cells) comparing to skn-1 embryos (with no pharynx) during microarray analysis.	Genes with at least 2 fold change in expression are considered differentially expressed.	WBPaper00024505:pharyngeal_enriched
	Transcripts expressed in pharynx, according to RNA tomography.	RNA tomography	WBPaper00055648:pharynx_expressed
	Enriched in pharynx).		WBPaper00029359_1458
	Transcripts uniquely expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_enriched
	Enriched in intestinal (adult), body wall muscle (adult), pharynx).		WBPaper00029359_1578
	Enriched in vulval muscle (adult), pharynx), pharynx), body wall muscle (larva).		WBPaper00029359_1225
	Enriched in pharynx), pharynx).		WBPaper00029359_1345
	Enriched in pharynx), pharynx).		WBPaper00029359_1320
	Enriched in pharynx).		WBPaper00029359_1326
	Enriched in pharynx).		WBPaper00029359_1439
	Transcription factors expressed exclusively in intestine, according to mRNA-tagging and RNAseq studies.	Cuffdiff algorithm was used. FPKM >= 1 was used as threshold across all tissues profiled for defining expressed genes.	WBPaper00046338:pharynx_unique

2011 Expression Patterns

• Primary Identifier: Expr4885
• Remark: Picture: FIG. 1D-G.
• Pattern: Expressed in a relatively broad range of tissues. Robustly expressed in vulval muscles, and modestly expressed in body wall muscles and in the pharynx. Expression of was also observed in the intestine and expression of asd-1 was observed in the nervous system. Widely expressed in the early embryos before morphogenesis.

• Primary Identifier: Expr4886
• Remark: Picture: FIG. 1D-G.
• Pattern: Expressed in a relatively broad range of tissues. Robustly expressed in vulval muscles, and modestly expressed in body wall muscles and in the pharynx. Expression of was also observed in the intestine. Widely expressed in the early embryos before morphogenesis.

• Primary Identifier: Expr4842
• Pattern: A-class motor neuron: enriched in embryo (2.9); not expressed in larva. Neuronal expression include: Weak in head and tail neurons, ventral cord. Also expressed in other cells: Pharynx, sheath cells, distal tip cell. Pan-neuronal: enriched in embryo (1.9); expressed in larva.

• Primary Identifier: Expr4838
• Remark: Picture: Figure 8 C and D.
• Pattern: The major site of agrin expression was around the pharynx and the staining was particularly enriched in the anterior part. The posterior bulb was labeled more weakly correlating with the fainter GFP reporter expression in the posterior part. Polyclonal antiserum staining resulted in the same staining pattern in wild type worms of different developmental stages. Young larvae (L1) generally showed stronger agrin staining compared to young adults. In addition to the pharynx staining in the wild type worms, the polyclonal antiserum stained the gut lumen both in the wild type worms as well as in the agrin mutants, but not when preimmune serum was used. The staining of the lumen of the gut represents an unrelated cross-reactivity of the antiserum, possibly corresponding to the background bands detected on the western blots.
• Subcellular Localization: Agrin was detected in the basal lamina around the pharynx procorpus and anterior bulb. Posterior bulb staining was weaker possibly due to poor antibody penetration.

• Primary Identifier: Expr4831
• Remark: Picture: Figure 1B, I and II.
• Pattern: The promoter extracted from C15C7.2 is able to drive GFP expression in the excretory cell, pharynx, pharyngeal neurons, and head neurons.

• Primary Identifier: Expr4834
• Remark: Picture: Figure 1D III and IV.
• Pattern: B0336.2 is able to drive GFP expression in the pharynx, gut, and head neurons.

• Primary Identifier: Expr4826
• Remark: Picture: fig. S3 A.
• Pattern: A transgene containing the sel-10 promoter driving green fluorescent protein (GFP) labeled a subset of neurons including the HSNL, which suggests that sel-10 is expressed in the HSNL. sel-10 promoter driven GFP is widely expressed in body wall muscles (not consistent though), intestine(not consistent), pharynx, distal tip cell, spermatheca, and within nervous system, it is expressed in HSNs, some ventral cord neurons, a bunch of unidentified head neurons and a few tail neurons. --Pers. Comm. from Mei Ding 11-20-07.

• Primary Identifier: Expr4790
• Remark: Reporter gene fusion type not specified.
• Pattern: The glt-5::gfp fusion is weakly expressed in the pharynx.

• Primary Identifier: Expr4788
• Pattern: A full-length glt-3-gfp fusion (later shown to be capable of rescuing the phenotypes of a glt-3 mutant strain) is expressed at increasing levels from late embryogenesis to adulthood throughout the body-spanning excretory canal cell.
• Subcellular Localization: The expression of GLT-3::GFP appears localized to the abluminal (basolateral) side.

• Primary Identifier: Expr4779
• Pattern: The fkb-6 transcript was temporally expressed in all stages from embryo to adult with predominant spatial expression being noted in the adult dorsal and ventral nerve cords. In addition, weaker spatial expression was noted in the pharynx, hypodermis, body wall muscle cells and some somatic and gut cells.

• Primary Identifier: Expr4771
• Pattern: Expressed in pharynx, intestine (basolateral membrane).
• Subcellular Localization: Expressed in basolateral membrane of intestine.

• Primary Identifier: Expr4764
• Pattern: CO3H5.2 gene has a broad expression pattern. This includes expression in the pharynx and pharyngeal gland cells, seam cells, spermatheca, stomatointestinal muscle, vulva and body wall muscle.

• Primary Identifier: Expr4731
• Remark: folt-1 = C06H2.4
• Pattern: Expression was consistently higher in the pharynx and the posterior part of intestine; it was also observed in the body wall muscles, head muscles and vulva muscles of these transgenic animals.

• Primary Identifier: Expr4738
• Remark: Reporter gene fusion type not specified.
• Pattern: tni-4::lacZ was expressed only in the pharynx from the 2-fold to adult stages.

• Primary Identifier: Expr4951
• Remark: Picture: Figure 2.
• Pattern: GLO-4::GFP showed a discrete punctate localization in many different tissues, including muscle, pharynx, gut, and nervous system.

• Primary Identifier: Expr4903
• Remark: Picture: Fig. 3A, E, F.
• Pattern: crm-1b expression was active in the entire pharynx and posterior gut.

• Primary Identifier: Expr4390
• Reporter Gene: To test the tissue specificity of the expression of Caenorhabditis mannosidase II, a promoter gfp reporter construct was designed to generate a translational fusion. To select easily for the low copy number transformants carrying the aman-2::gfp reporter fusion, the 2000 bp upstream of the aman-2 gene were ligated into a vector carrying not only a gfp sequence but also the unc-119 gene and stably integrated into unc-119 (ed3) mutants. Two independent low copy number transgenic lines were generated and analyzed. The reporter plasmid used was a form of the pPD95.67 (L2459) promoterless gfp vector3. This vector was then modified by insertion of a HindIII/XbaI fragment carrying the unc-119 gene into its multiple cloning site to generate pPD95.67/unc-119. Then, a genomic fragment corresponding to the 2000 bp upstream of the aman-2 gene was isolated by PCR using the primers ManII_prom/1/XbaI gctctagacggacgagaagtacaaat and ManII_prom/2/XbaI gctctagacccatgctttatcttgccat. Both the fragment and the pPD95.67/unc-119 vector were cut with XbaI and ligated. A selected clone was sequenced and verified to contain the expected aman-2 upstream region and was used to transform unc-119 (ed3) mutants with a particle gun. --precise ends.
• Pattern: Confocal microscopy indicated that the aman-2 promoter is most active in the gut wall, pharynx and grinder, hypodermal cells, and cells of the nervous system (ventral nerve cord cells, neurons surrounding the pharyngeal bulb and in the head) in adult animals; also rather ubiquitous expression was seen in larvae.

• Primary Identifier: Expr4386
• Pattern: SDN-1::GFP transgenes were expressed in many ventral neuroblasts during their migrations, prior to and during epidermal enclosure; in later embryogenesis SDN-1::GFP was mainly expressed in the nervous system (nerve ring localization, nr) and pharynx (ph).

• Primary Identifier: Expr4387
• Pattern: GPN-1::GFP was expressed in a smaller number of neuroblasts prior to epidermal enclosure. In later embryogenesis GPN-1::GFP was expressed strongly in the developing pharynx and in ventral cord neurons.

• Primary Identifier: Expr4374
• Remark: Reporter gene fusion type not specified.
• Pattern: Expressed in pharynx.

• Primary Identifier: Expr4342
• Pattern: In first stage larvae (L1) of both sexes, ceh-22b::VENUS expression was not detected in SGPs(somatic gonadal precursor) at hatching, but became visible midway through the first larval stage (L1). After the SGP divided, the intensity of the reporter began to increase in distal SGP daughters (Z1.a and Z4.p) and began to diminish from proximal SGP daughters (Z1.p and Z4.a). In hermaphrodites, both progeny of the distal SGP daughter retained robust ceh-22b::VENUS expression through L2 or early L3. In males, the distal SGP daughter, which does not divide further, retained strong expression until L3; the expression decreased during L4. The ceh-22b::VENUS reporter was also expressed in the pharynx, intestine, and ventral nerve cord as well as in unidentified neurons in the head and tail. Expression in the pharynx and intestine was sustained throughout larval development into adulthood; expression in the ventral nerve cord was visible until L3.

• Primary Identifier: Expr4345
• Pattern: GFP expression is nearly ubiquitous in the early embryo. At early comma stage expression becomes intensely focused in the anterior of the embryo. Strong expression is observed from the pharynx and some unidentified head neurons beginning around the 1.5-fold stage. After hatching, GFP expression is present in the ALM and PLM neurons. Beginning in late L1 stages expression comes on in the PVD neurons and some time later in the AVM. No significant expression of GFP was observed in ventral cord commissural motoneurons.

• Primary Identifier: Expr4327
• Remark: No obvious difference in expression was observed between this particular mir-84::gfp fusion gene and one in which 8.1 kb of sequence upstream of mir-84 was fused to yellow fluorescent protein, kindly provided by A. Yoo and I. Greenwald.
• Pattern: Transgenic mgEx674[mir-84::gfp] animals expressed GFP in the lateral hypodermal seam cells and other cells. The mir-84::gfp reporter was expressed in seam cells during early larval stages in some transgenic animals, although expression was more prevalent in L3-stage and older animals.

• Primary Identifier: Expr4406
• Remark: No detailed description on cellular expression patterns in other life stages..
• Pattern: Expressed in pharynx.

• Primary Identifier: Expr4294
• Remark: No GO_term assigned.
• Pattern: Expression of GFP-UNC-78 was detected in the pharynx, body wall muscle, spermatheca, and vulva.
• Subcellular Localization: The GFP-UNC-78 fusion protein localized in a striated pattern in live animals.

• Primary Identifier: Expr4290
• Pattern: Expressed in the intestine in adult worms, and in all four larval stages. The fat-5 promoter::GFP expressing lines showed additional expression in the pharynx and tail cells after hatching and throughout the lifespan.

• Primary Identifier: Expr4249
• Pattern: The NUD-2 fusion protein was expressed within neurons of the ventral cord as well as the pharynx, seam cells of the hypodermis, and in the vulva muscle cells.

• Primary Identifier: Expr4574
• Pattern: In wild-type animals, sax-7 is expressed in multiple tissues with robust SAX-7 accumulation in the nervous system. Expression was detected in pharynx, gonad, and the nerve ring and ventral nerve cord.

• Primary Identifier: Expr4567
• Pattern: Expression of fshr-1 mRNA was observed in a number of somatic tissues, with the strongest expression occurring in the intestine. No expression of fshr-1 was detected in the germline when authors used probes to three different regions of the gene.

• Primary Identifier: Expr4677
• Pattern: The expression of UBXN-6::GFP was very weak. UBXN-6::GFP was expressed only in pharynx and several nerve cells in head of adult but not in embryos.

0 Life Stages

3 Parents

Definition	Name	Synonym	Primary Identifier
inner tube of two concentric tubes that make up the body	digestive tract		WBbt:0005743
	alimentary system		WBbt:0005748
a collection of cells or cell groups that collectively perform a function	organ		WBbt:0003760