WormMine: AnatomyTerm WBbt:0005776

• Definition: gland cell of the secretory-excretory system, sends processes to ring, opens into excretory duct.
• Name: excretory gland cell
• Primary Identifier: WBbt:0005776
• Synonym: exc gl

2 Children

Definition	Name	Synonym	Primary Identifier
left nucleus of binuclear syncytium excretory gland, fused, send processes to ring,open into excretory duct.	exc_gl_L nucleus	ABplpapapaa nucleus	WBbt:0004536
right nucleus of binuclear syncytium excretory glands, fused, send processes to ring,open into excretory duct.	exc_gl_R nucleus	ABprpapapaa nucleus	WBbt:0004535

4 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Top 300 transcripts enriched in excretory gland cell according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Excretory_gland
	Transcripts enriched in Excretory_gland_cell according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:Excretory_gland_cell_enriched
	Single-cell RNA-Seq cell group 65 expressed in: Excretory gland.	CellRanger, DecontX, Monocle3, Louvain algorithm.	WBPaper00065623:65
	Single-cell RNA-Seq cell group 89_0 expressed in gland.	scVI 0.6.0	WBPaper00065841:89_0

65 Expression Patterns

• Primary Identifier: Expr4852
• Pattern: A-class motor neuron: enriched in larva (1.8); not expressed in embryo. Neuronal expression include: All ventral cord motor neurons, head and tail neurons, touch neurons. Also expressed in other cells: Body muscle, anal depressor, sphincter muscle? Excretory gland cells?. Pan-neuronal: enriched in larva (3.2); not expressed in embryo.

• Primary Identifier: Expr4784
• Pattern: Three independent transgenic lines display GFP fluorescence exclusively in VB motor neurons in the ventral nerve cord. ceh-12::GFP, is expressed in all 11 VB motor neurons and in a single head neuron, RID; occasional weak GFP expression was observed in the pharyngeal/intestinal valve cell and in the excretory gland cell.

• Primary Identifier: Expr4281
• Reporter Gene: [wrk-1::TM-gfp] translational fusion. wrk-1 expression was determined by means of a reporter construct (wrk1::TM::gfp), in which 4 kb of sequences upstream of the ATG start codon, all exons, and the first three introns of the wrk-1 locus were fused in frame to gfp. This construct is able to rescue the phenotype of wrk-1 mutant animals. See Transgene otEx2389. [wrk-1::gfp] transcriptional fusion in which 4 kb of sequences upstream of the ATG start codon was fused to GFP. See Transgene otEx203 [wrk-1::gfp] translational fusion. See Transgene otEx2522.
• Pattern: The wrk-1 gene is expressed in ventral midline cells, namely in the eMNs. Additional expression is observed in a subset of head neurons, including interneurons (AIY class), sensory neurons (ASI class), and head motoneurons (SMDV/D class), and glial-type sheath and socket cells. Outside the nervous system, the most prominent sites of wrk-1 expression include the intestine, excretory gland cell, distal tip cell, and coelomocytes.

• Primary Identifier: Expr4537
• Pattern: Expressed in ASEL, AWCL/R (faint) excretory gland and canal cells.

• Primary Identifier: Expr5136
• Remark: Strain: BC14237
• Reporter Gene: [C03H5.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCATTTTCCATTTTCGTC] 3' and primer B 5' [TCGTTAGCTCGATTGATGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5404
• Remark: Strain: BC11436
• Reporter Gene: [C33A11.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATGTCAAGCATTGAATCGGT] 3' and primer B 5' [TCGTACTTTCGGATCACGG] 3'.
• Pattern: Adult Expression: intestine - posterior cells; rectal epithelium; excretory cell; excretory gland cells; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; amphids; tail neurons; phasmids; Larval Expression: intestine - posterior cells; rectal epithelium; excretory cell; excretory gland cells; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; amphids; tail neurons; phasmids

• Primary Identifier: Expr5064
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14242
• Reporter Gene: [B0403.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCGTGAAAATTATCAAAACTTCG] 3' and primer B 5' [AGCCATGACGATCCACTAATCT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; Reproductive System; uterine-seam cell; excretory gland cells; coelomocytes; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; intestine; excretory gland cells; coelomocytes; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5042
• Remark: Strain: BC14636
• Reporter Gene: [ckb-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGTGAAAAGTTTAACTACAAAACTG] 3' and primer B 5' [TTTGGAGAAACAAAATTGTATGG] 3'.
• Pattern: Adult Expression: Reproductive System; uterine-seam cell; excretory gland cells; Larval Expression: pharyngeal gland cells; intestine; Reproductive System; uterine-seam cell; excretory gland cells

• Primary Identifier: Expr5944
• Remark: Also expressed in (comments from author) : Mosaic population.Hypodermis: only in the tail.Coelomocytes: saw the 4 ventral cells. Strain: BC14222
• Reporter Gene: [F33H2.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACATAATCGATAGACTCCCAGC] 3' and primer B 5' [TAGACGGGATGATTGAGGATG] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; excretory gland cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; distal tip cell; developing gonad; developing vulva; developing uterus; uterine-seam cell; developing spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory gland cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body

• Primary Identifier: Expr5887
• Remark: Strain: BC14620
• Reporter Gene: [aat-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGCAGAGAATCAGAGAAGCAAAT] 3' and primer B 5' [TTTCAGCTGTGATCCTGAAAAAT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; gonad sheath cells; excretory cell; excretory gland cells; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; excretory cell; excretory gland cells; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; unidentified cells in tail

• Primary Identifier: Expr6512
• Remark: Strain: DM11928
• Reporter Gene: [mdt-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATTTCATTGAGTTTTCCCATAA] 3' and primer B 5' [TTCGCTGATCTTTCTACTCTGCT] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Reproductive System; uterus; spermatheca uterine valve; gonad sheath cells; excretory gland cells; Nervous System; head neurons; amphids; tail neurons; phasmids; unidentified cells in head; unidentified cells in body ; Larval Expression: intestine; rectal gland cells; Reproductive System; developing uterus; Nervous System; head neurons; amphids; tail neurons; phasmids; unidentified cells in head; unidentified cells in body

• Primary Identifier: Expr6506
• Remark: Also expressed in (comments from author) : Note: primers are incorrect. Strain: BC15433
• Reporter Gene: [rpl-28::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCCCTTCCCCCTATCTT] 3' and primer B 5' [CGTCGGAGATTTTACCTGGA] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; spermatheca; body wall muscle; excretory gland cells; Nervous System; head neurons; tail neurons; Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; developing uterus; body wall muscle; excretory gland cells; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr6610
• Remark: Strain: BC14863
• Reporter Gene: [tre-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGACTTACAGCGCCCCG] 3' and primer B 5' [TGACGGGCTGATTTTGGT] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; vulval muscle; head mesodermal cell; excretory gland cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; head mesodermal cell; excretory gland cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body

• Primary Identifier: Expr13873
• Pattern: Bright fluorescence was detected in post-gastrulating embryos in regions corresponding to intestinal cells and the dorsal body wall muscle quadrant. Expression continued throughout all larval stages and into adulthood in most tissues except for the gonadal cells. By mid L4, GFP fluorescence was visible in intestinal and muscle cells, with concentrated regions within the pharyngeal and vulval muscles. There was an obvious change in the expression pattern of young adults as fluorescence decreased in the anterior head and posterior tail regions, but the intestine, pharynx and particularly the spermatheca continued to exhibit bright reporter expression. Fluorescence was equally observed in the excretory system within structures resembling the excretory gland cells, the intestinal-rectal valve and anus. Interestingly, no expression was observed in the male gonad.

• Primary Identifier: Expr6827
• Remark: Strain: BC11847
• Reporter Gene: [sel-9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGATGCATTGGCATGACT] 3' and primer B 5' [ATGTCAGCGAATTGATTTTGTTAG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; excretory cell; excretory gland cells; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; unidentified cells; Larval Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; excretory cell; excretory gland cells; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; unidentified cells

• Primary Identifier: Expr6686
• Remark: Strain: BC14878
• Reporter Gene: [tsg-32::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTGCGCGGCAATTTTT] 3' and primer B 5' [GAGATTGTAGCACTTGCTGGG] 3'.
• Pattern: Adult Expression: Reproductive System; spermatheca; gonad sheath cells; excretory gland cells; Nervous System; pharyngeal neurons; Larval Expression: intestine; rectal gland cells; Reproductive System; developing spermatheca; gonad sheath cells; excretory gland cells; Nervous System; pharyngeal neurons

• Primary Identifier: Expr6130
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15931
• Reporter Gene: [F52A8.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTTCGAGCGTTATTGCCAG] 3' and primer B 5' [GGTCGTTAAAAGGATTTTTGGA] 3'.
• Pattern: Adult Expression: Reproductive System; vulva other; spermatheca; excretory gland cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; pharyngeal neurons; neurons along body; tail neurons; Larval Expression: excretory gland cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; pharyngeal neurons; neurons along body; tail neurons

• Primary Identifier: Expr6188
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15905
• Reporter Gene: [syn-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAACAGCATCAACAAGTCTCTCTG] 3' and primer B 5' [CGACATCGAACAAACTGAAAAA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulva other; body wall muscle; excretory gland cells; Nervous System; head neurons; tail neurons; Larval Expression: pharynx; anal depressor muscle; body wall muscle; excretory gland cells; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr6185
• Remark: Strain: BC13899
• Reporter Gene: [F54G2.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAGACACATAATTCACTCGGTT] 3' and primer B 5' [AGTACCTAGGAATGGAAACGCA] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; Larval Expression: intestine; excretory gland cells; Nervous System; head neurons

• Primary Identifier: Expr6299
• Remark: Also expressed in (comments from author) : ubiquitous expressionMosaic population. Strain: BC14251
• Reporter Gene: [rpl-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAAGAGACGCAGGTGAGTT] 3' and primer B 5' [CTTTGGTGGCATGATGAGTG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; vulval muscle; body wall muscle; hypodermis; seam cells; excretory cell; excretory gland cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; neurons along body; tail neurons; unidentified cells; Larval Expression: pharynx; pharyngeal gland cells; pharyngeal-intestinal valve; intestine - posterior cells; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; developing uterus; body wall muscle; hypodermis; seam cells; excretory cell; excretory gland cells; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; neurons along body; tail neurons; unidentified cells

• Primary Identifier: Expr6291
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15083
• Reporter Gene: [H37N21.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGCCACATTACCAATAGTTTAGG] 3' and primer B 5' [CACCGGAACTGACGATTG] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; seam cells; excretory gland cells; Nervous System; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; body wall muscle; seam cells; excretory gland cells; Nervous System; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Marker41
• Remark: Picture: Figure 2A.
• Pattern: Expressed in ASEL and excretory gland.

• Primary Identifier: Expr15244

• Primary Identifier: Expr15249

• Primary Identifier: Expr15253

• Primary Identifier: Expr15228

• Primary Identifier: Expr15230

• Primary Identifier: Expr15231

• Primary Identifier: Expr15232
• Pattern: Unc-64 isoform A and B.

• Primary Identifier: Expr15234

12 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The whole period of embryogenesis in the nematode Caenorhabditis elegans, from the formation of an egg until hatching.		embryo Ce	WBls:0000003
	The C. elegans life stage spanning 620-800min(hatch) after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. A stage after elongation is over. The last stage of embryogenesis. Also called pre-hatched embryo, late embryo or morphogenetic embryo.		fully-elongated embryo Ce	WBls:0000021
	The C. elegans life stage spanning 350-620min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The stage that embryo starts elongation until elongation is over.		elongating embryo Ce	WBls:0000015
	The C. elegans life stage spanning 290-350min after first cleavage at 20 Centigrade. Proliferate from 421 cells to 560 cells. The stage when embryo just finished gastrulation and is enclosing.		enclosing embryo Ce	WBls:0000013
	The C. elegans life stage spanning 100-290min after first cleavage at 20 Centigrade. Proliferate from 28 cells to 421 cells. Referring to the whole period of gastrulation.		gastrulating embryo Ce	WBls:0000010
	The C. elegans life stage spanning 0-350min after first cleavage at 20 Centigrade. Proliferate from 1 cell to 560 cells. From start of first cleavage until cleavage is over.		proliferating embryo Ce	WBls:0000004
	The C. elegans life stage spanning 520-620min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and tripple fold. A stage between 2-fold embryo and fully-elongated embryo. Also called pretzel embryo or pretzel stage.		3-fold embryo Ce	WBls:0000020
	The C. elegans life stage spanning 420-460min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and fold back 50%. A stage between comma embryo and 2-fold embryo.		1.5-fold embryo Ce	WBls:0000018
	The C. elegans life stage spanning 390-420min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo looks like a comma. A stage between bean embryo and 1.5-fold embryo.		comma embryo Ce	WBls:0000017
	The C. elegans life stage spanning 460-520min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and double fold. A stage between 1.5-fold embryo and 3-fold embryo.		2-fold embryo Ce	WBls:0000019
	The C. elegans life stage spanning 350-390min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. Emrbyo elongation started but have not formed comma shape yet. The shape of embryo looks like a lima bean. A stage right before comma embryo. Also called lima embryo or lima bean stage.		bean embryo Ce	WBls:0000016
	The C. elegans life stage spanning 210-350min after first cleavage at 20 Centigrade. Proliferate from 421 cells to 560 cells. The stage before the fast cleavage of cells finishes.		late cleavage stage embryo Ce	WBls:0000014

5 Parents

Definition	Name	Synonym	Primary Identifier
	excretory system		WBbt:0005736
A variety of very different cell types which share cytoplasmic features (such as large membrane-bound granules) that suggest a role in secretion, thus termed gland cells.	gland cell		WBbt:0003670
embryonic cell	ABplpapapa		WBbt:0005908
cell that has more than one nucleus.	syncytium	syncitium	WBbt:0008074
embryonic cell	ABprpapapa		WBbt:0006487