WormMine: AnatomyTerm WBbt:0006756

• Definition: A valve tissue that connects the spermatheca and the uterus of a hermaphrodite gonad.
• Name: spermathecal-uterine junction
• Primary Identifier: WBbt:0006756
• Synonym: sp-ut valve

2 Children

Definition	Name	Synonym	Primary Identifier
spermathecal-uterine junction of the posterior gonad arm.	posterior spermathecal-uterine junction	gon_herm_sujn_P	WBbt:0006758
spermathecal-uterine junction of the anterior gonad arm.	anterior spermathecal-uterine junction	gon_herm_sujn_A	WBbt:0006757

3 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Single-cell RNA-Seq cell group 11_1 expressed in epithelium.	scVI 0.6.0	WBPaper00065841:11_1
	Single-cell RNA-Seq cell group 11_2 expressed in epithelium.	scVI 0.6.0	WBPaper00065841:11_2
	Single-cell RNA-Seq cell group 54 expressed in: Spermatheca-Uterine junction.	CellRanger, DecontX, Monocle3, Louvain algorithm.	WBPaper00065623:54

58 Expression Patterns

• Primary Identifier: Expr4898
• Remark: Picture: Figure S2.
• Pattern: SRP-6::GFP was expressed in the socket cells, the pharyngeal-intestinal valve, vulval hypoderm, the spermatheca and spermathecal-uterine junction and the intestine. Corresponding expression was seen in the srp-6::lacZ fusions.

• Primary Identifier: Expr4889
• Remark: Picture: Fig. 4.
• Pattern: pQC106, with the 3.0 kb promoter, showed expression in the same cells as pQC105 and also in rectal cells, vulva cells, the spermatheca-uterine valve and in body wall muscle cells and neurons of the ventral nerve cord.

• Primary Identifier: Expr5265
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13892
• Reporter Gene: [C14A4.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCGAATTTATAGAAAATGGCAGT] 3' and primer B 5' [ATTGTGAAACTGCTGAAATGAAAA] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; uterus; vulva other; spermatheca uterine valve; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; Reproductive System; developing gonad; developing vulva; developing uterus; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5176
• Remark: Also expressed in (comments from author) : GLR head neurons are expressing (Hall Lab, 2005). Strain: BC14109
• Reporter Gene: [snx-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAAAAACTGAAGGTTGGTTGT] 3' and primer B 5' [CTTCCGACAAGATTTCCAGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; arcade cells; intestine; Reproductive System; spermatheca uterine valve; head mesodermal cell; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; arcade cells; intestine; head mesodermal cell; coelomocytes; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5143
• Remark: Also expressed in (comments from author) : Expression in 2 non-DiI stained head neuron pairs between anterior and posterior pharyngeal bulbs, sending dendrites to tip of nose (Hober Lab apr 2005). Strain: BC15142
• Reporter Gene: [srd-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGTCTTTTTCTATCGACGAGC] 3' and primer B 5' [TCTTGTGCGATTCTGACAAATTA] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; spermatheca uterine valve; Nervous System; head neurons; tail neurons; phasmids; Larval Expression: intestine; Reproductive System; Nervous System; head neurons; tail neurons; phasmids; unidentified cells in body

• Primary Identifier: Expr5453
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11439
• Reporter Gene: [tbb-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAAACATATCGAGGCTGAAAATC] 3' and primer B 5' [TTGCTGAAAAGGTCGTAATGAAT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; Reproductive System; uterus; vulva other; spermatheca uterine valve; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; Reproductive System; developing vulva; developing uterus; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5422
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15496
• Reporter Gene: [C34F11.3a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATTTCACGCCTCACTCAG] 3' and primer B 5' [GTGTCTTCGGGATTCTTCCTATAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca uterine valve; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5524
• Remark: Also expressed in (comments from author) : very low intensity GFP. Strain: BC12898
• Reporter Gene: [eif-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCAGTGCGAATCTCGTC] 3' and primer B 5' [TCAACCGGGAAACTGGAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal epithelium; Reproductive System; vulva other; spermatheca uterine valve; spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells; Larval Expression: pharynx; intestine; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells

• Primary Identifier: Expr5350
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15705
• Reporter Gene: [rap-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGATCGTTTATCAACACTTCCTT] 3' and primer B 5' [ATCTGTTATGGTGTTGTTGATGCT] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Reproductive System; spermatheca uterine valve; body wall muscle; Nervous System; head neurons; tail neurons; Larval Expression: intestine; rectal gland cells; body wall muscle; hypodermis; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr5333
• Remark: Strain: BC15292
• Reporter Gene: [C25A1.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTGTTCCACTCATCTCTTCG] 3' and primer B 5' [TATCCCGATATTTTCCACTGAAAT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca uterine valve; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons

• Primary Identifier: Expr5597
• Remark: Also expressed in (comments from author) : No comment. Strain: BC11002
• Reporter Gene: [C56C10.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAACGTTTTTCTCTATTTGGTGA] 3' and primer B 5' [TGCCGAACAGGCTGATTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; spermatheca uterine valve; spermatheca; gonad sheath cells; body wall muscle; hypodermis; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; body wall muscle; hypodermis; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5999
• Remark: Also expressed in (comments from author) : 95% showed our listed expression pattern, other animals showed hypodermal or neural expression Strain: BC14274
• Reporter Gene: [dnj-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGGCATTCACTGAAAATTAAA] 3' and primer B 5' [CCTGTTTCCTTCACGATTTTG] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; spermatheca uterine valve; spermatheca; body wall muscle; excretory cell; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; excretory cell

• Primary Identifier: Expr5963
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13968
• Reporter Gene: [F35H12.2a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGGAATCAAATCCCATTTCTGAT] 3' and primer B 5' [TGCTCCGTTGAAATTTGTACTTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; uterus; spermatheca uterine valve; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; Reproductive System; distal tip cell; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5943
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15410
• Reporter Gene: [dog-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATGCCTCTTCAGAGATTTCG] 3' and primer B 5' [TGGATCGCTTGAGGACATAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; Reproductive System; uterus; spermatheca uterine valve; spermatheca; Nervous System; nerve ring; ventral nerve cord; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; Reproductive System; developing vulva; developing uterus; uterine-seam cell; developing spermatheca; Nervous System; nerve ring; ventral nerve cord; tail neurons

• Primary Identifier: Expr6569
• Remark: Strain: BC14634
• Reporter Gene: [hum-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTAAGCTAACGAATCTTAGAGCG] 3' and primer B 5' [ACTACGAATGGAAATGGGAAAAT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; Reproductive System; uterus; vulva other; spermatheca uterine valve; Larval Expression: pharynx; pharyngeal-intestinal valve; Reproductive System; developing vulva; developing uterus; excretory cell; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr6513
• Remark: Also expressed in (comments from author) : No comment. Strain: BC11928
• Reporter Gene: [mdt-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATTTCATTGAGTTTTCCCATAA] 3' and primer B 5' [TTCGCTGATCTTTCTACTCTGCT] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; uterus; spermatheca uterine valve; Nervous System; head neurons; unidentified cells; Larval Expression: intestine; Reproductive System; developing uterus; Nervous System; head neurons; unidentified cells

• Primary Identifier: Expr6512
• Remark: Strain: DM11928
• Reporter Gene: [mdt-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATTTCATTGAGTTTTCCCATAA] 3' and primer B 5' [TTCGCTGATCTTTCTACTCTGCT] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Reproductive System; uterus; spermatheca uterine valve; gonad sheath cells; excretory gland cells; Nervous System; head neurons; amphids; tail neurons; phasmids; unidentified cells in head; unidentified cells in body ; Larval Expression: intestine; rectal gland cells; Reproductive System; developing uterus; Nervous System; head neurons; amphids; tail neurons; phasmids; unidentified cells in head; unidentified cells in body

• Primary Identifier: Expr6616
• Remark: Strain: BC14362
• Reporter Gene: [T05D4.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAAGAACAACTGTCAACTATGGG] 3' and primer B 5' [GCGAGTAAGAAGCGATTTTAGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; spermatheca uterine valve; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr6412
• Remark: Strain: BC14068
• Reporter Gene: [M03A8.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCAAAATTAGGGAAATCCGA] 3' and primer B 5' [AGAGTGATTTGTGAAACTGAAAAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; spermatheca uterine valve; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; intestine; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr6778
• Remark: Also expressed in (comments from author) : head neurons are possibly amphids. Strain: BC10809
• Reporter Gene: [T26C12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCTCAACGTGTTTCGTCA] 3' and primer B 5' [GTACGATGGTTTACCCGGC] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; uterus; vulval muscle; spermatheca uterine valve; body wall muscle; hypodermis; Nervous System; head neurons; Larval Expression: intestine; body wall muscle; hypodermis; Nervous System; head neurons

• Primary Identifier: Expr6808
• Remark: Strain: BC10909
• Reporter Gene: [W01A11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTTTTATCGCCAAGTTAATGT] 3' and primer B 5' [GAATACCGATCTGAATTTCAATAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal sphincter; Reproductive System; distal tip cell; uterine muscle; spermatheca uterine valve; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal sphincter; Reproductive System; distal tip cell; developing spermatheca; body wall muscle; Nervous System; nerve ring; head neurons

• Primary Identifier: Expr6117
• Remark: Also expressed in (comments from author) : unidentified cells in head and tail, some probably neural, also maybe head mesodermal cell.Mosaic population. Strain: BC12839
• Reporter Gene: [alg-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTGTCACCGCGTAGTCTT] 3' and primer B 5' [GTCGTTTGAGGCGACGTTAG] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; uterus; vulva other; spermatheca uterine valve; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; Reproductive System; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr8673
• Remark: Picture: Fig 3.
• Pattern: Expression in the alimentary canal: Strong and consistent expression in anterior arcades, posterior arcades, M1, B cell. Weak or rare expression in intestine. Expression in the nervous system: Amsh, CEPsh, CEPso, ILso, OLso, Phso, DVC, MI. Expression in the reproductive system: In adult stage, expressed in gonad sheath, uterus, vulva(low), spermatheca, Sp-ut valve. In developing larva stage, expressed in uterus, vulva, spermatheca, Sp-ut valve. inx-5 first appears in the developing hypodermis at bean stage and then in the excretory cell at three-fold stage.

• Primary Identifier: Expr1118
• Pattern: The tissue distribution of HSP43 is localized to specific cells of the vulva, to the spermathecal valve and junctions between cells of the spermathecal cage. It is also concentrated in regions of contact between muscle cells or between muscle cells and the overlying hypodermis. In males, HSP43 was also found to be concentrated in specialized structures of the tail, including rays, copulatory spicules and other structures too poorly resolved to permit reliable identification. This signal was HSP43-specific, and not due to autofluorescence of tail structures, since it was abolished when the antibody was pre-incubated with excess HSP43 protein.

• Primary Identifier: Expr2894
• Remark: Reporter gene fusion type not specified.
• Pattern: The longest construct, containing 10 kb of 5 upstream region from the first lin-3 exon, expresses lin-3::gfp in pharynx; spermathecal-uterine junction core cells and later in the spermatheca valve; pre-anchor (AC)/ventral uterine precursor (VU) cells and later in the anchor cell in the somatic gonad; vulF cells of the primary vulval lineage cells; and F, U and some of the B progeny cells in the male tail. This expression pattern was not affected by the different genetic backgrounds (dpy-20, pha-1 and unc-119) rescued by the corresponding co-injected rescue plasmids, implying that the gfp expression pattern is established by the lin-3 regulatory region. LIN-3 expression in different cells was temporally distinct as well. Expression in the pharynx was observed throughout post-embryonic stages. Spermathecal-uterine junction core cells, which later form the spermatheca valve, started expressing lin-3::gfp at the late L3 larval stage.

• Primary Identifier: Expr7104
• Remark: Strain: BC14299
• Reporter Gene: [nhr-112::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGGAAAACGATTAGGTGATTT] 3' and primer B 5' [GCAGATTTTGCAGATTTTGAGA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal epithelium; Reproductive System; distal tip cell; uterus; vulva other; spermatheca uterine valve; hypodermis; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; hypodermis; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr7228
• Remark: Strain: BC14566
• Reporter Gene: [ZK632.12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGTTTCTTTCACTCTTGCC] 3' and primer B 5' [GATCAACCATTGTGTTTTGTGATT] 3'.
• Pattern: Adult Expression: pharynx; intestine - . cells; Reproductive System; uterus; vulva other; spermatheca uterine valve; Larval Expression: pharynx; intestine

• Primary Identifier: Expr1200138
• Pattern: Data from the TransgeneOme project

• Primary Identifier: Expr9214
• Pattern: NCK-1B isoform was expressed exclusively in the vulva cells of the developing vulva, pharynx, intestine, distal tip cells (DTCs), gonad arms and spermatheca. In embryos, NCK-1B-GFP is expressed in the intestine, nervous system, epidermal cells and pharynx. In adult animals, NCK-1B-GFP is expressed in the nerve ring, amphid neurons, ventral nerve cord (VNC) and dorsal nerve cord (DNC), SDQ neurons, mechanosensory neurons (PVM and AVM), as well as in the CAN and HSN neurons. NCK-1B is also expressed in non-neuronal cells. NCK-1B is expressed in vulB1, vulB2, vulA, vulF and vulD cells, as well as in the leading edge (arrows) of the migrating vulva cells. In addition, NCK-1B is expressed in the spermathecal-uterine junction (sujn).
• Subcellular Localization: The NCK-1B isoform was localized to the cytoplasm and nucleus. The nuclear localization appeared to be strong.

• Primary Identifier: Expr1209
• Remark: Identical expression patterns were obtained with these plasmids, although there appeared to be more cytoplasmic staining with nex-1-GFP 1 while nex-1-GFP 2 led to more concentrated nuclear staining in the same cells. The significance of these differences is presently unknown since both plasmids should express identical proteins; however, the observations made with the two different plasmids were made at different times so uncontrolled differences, such as variance in trans-gene dosage, between the experiments may have contributed to this difference. See Expr1210 for antibody staining of this gene.
• Pattern: The GFP is diffusely localized throughout the gland cell bodies within the terminal bulb of the pharynx, immediately anterior to the autofluorescent yellow granules that fill the cells of the intestine. When the vector nex-1-GFP 2 was used, punctate staining was also seen representing the nuclei of the two g1 gland cells of the terminal bulb. GFP staining was diffuse throughout the volume of the cell. Fluorescence of the spermathecal valve was also marked in nematodes expressing nex-1-GFP 2. The spermathecal valve is a single cell with four nuclei that is the product of the fusion of four cells. A region of nex-1 expression that was identified by the nex-1-GFP markers but was not identified by immunolocalization is the hypodermal cells.
• Subcellular Localization: nuclei

0 Life Stages

2 Parents

Definition	Name	Synonym	Primary Identifier
organ in hermaphrodite animal that produces both ova and sperm.	hermaphrodite gonad	ovotestis	WBbt:0005178
Association of cells with a common embryological origin or pathway and similar structure and function. Usually, cells of a tissue are contiguous at cell membranes and may be of one or more types. Tissues aggregate to form organs.	Tissue		WBbt:0005729