WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: unidentified cells in head; Larval Expression: unidentified cells in head; Primary Identifier  Expr5233
Remark  Also expressed in (comments from author) : Note: primers are not unique and produce 2 products.Unidentified cells in head, possibly neural. Strain: BC11180 Reporter Gene  [ceh-33::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTCTCAAGTCGCCTAATCC] 3' and primer B 5' [CGGTTGGATATTGCTCGGGTTG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
anterior-most body region containing the pharynx. head   WBbt:0005739

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000454 ceh-33 C10G8.7 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023