WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: hypodermis; Primary Identifier  Expr5487
Remark  Strain: BC13858 Reporter Gene  [C42C1.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGAGTTGAGTCATATTTTGGCTTT] 3' and primer B 5' [AATAAACCATTTTTGTTCCCATGT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00016583 tag-335 C42C1.5 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023