WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: hypodermis; Larval Expression: hypodermis; Primary Identifier  Expr5468
Remark  Also expressed in (comments from author) : embryos have highest intensity GFPMosaic population. Strain: BC13411 Reporter Gene  [nas-9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTTCAAATGTGGAATAAACCTGT] 3' and primer B 5' [TGAACAGAATGATGAATTGCG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003528 nas-9 C37H5.9 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023