WormMine: ExpressionPattern Expr5441

• Pattern: Adult Expression: pharynx; anal depressor muscle; body wall muscle; unidentified cells in tail ; Larval Expression: body wall muscle; unidentified cells in tail
• Primary Identifier: Expr5441
• Remark: Strain: BC14336
• Reporter Gene: [pas-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGCTGGTTTATTGATTGTAGAGA] 3' and primer B 5' [GATCGTATCTGTTGATCTGAAAAA] 3'.

4 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion.	body wall musculature	body muscle	WBbt:0005813
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents.	anal depressor muscle	dilator muscle	WBbt:0004292
posterior region, from rectum to the end	tail		WBbt:0005741

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00003925	pas-4	C36B1.4	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023