WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: excretory cell; Larval Expression: excretory cell; Primary Identifier  Expr5302
Remark  Also expressed in (comments from author) : incomplete. To be updated. Strain: BC10556 Reporter Gene  [cft-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [tta atg ttt gtc cat cgt attg] 3' and primer B 5' [tgaaaaatttgacaaagagtgga] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000477 cft-1 C18C4.2 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023