WormMine: ExpressionPattern Expr7189

• Pattern: Larval Expression: intestine; rectal gland cells
• Primary Identifier: Expr7189
• Remark: Also expressed in (comments from author) : did not detect GFP after L2 stage. Strain: BC14308
• Reporter Gene: [ZK1127.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTTCTTCTGCTTTTGGAGATG] 3' and primer B 5' [CTGAAAAATGTGTCCATCAGTCA] 3'.

2 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
	rectal gland cell		WBbt:0005799

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00022852	ZK1127.5	ZK1127.5	Caenorhabditis elegans

1 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023