WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Nervous System; ventral nerve cord; Larval Expression: Nervous System; ventral nerve cord; unidentified cells; Primary Identifier  Expr5645
Remark  Also expressed in (comments from author) : Strain is not available as of 3 Dec 2003 Strain: BC11424 Reporter Gene  [del-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAATTCAATATTGCTGCTCGGATA] 3' and primer B 5' [TTTTTCACCCCATCTTTTCAA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

2 Anatomy Terms

Definition Name Synonym Primary Identifier
neuron with cell body associated with the ventral nerve cord. ventral cord neuron ventral cord motoneuron WBbt:0005300
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000952 del-1 E02H4.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023