WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: head neurons; unidentified cells in head; unidentified cells in tail ; Primary Identifier  Expr6434
Remark  Strain: BC12360 Reporter Gene  [amt-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATATTTTGGAGGGAAATACGTCAA] 3' and primer B 5' [CCGGTCCTGCGATTATTCT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
posterior region, from rectum to the end tail   WBbt:0005741
anterior-most body region containing the pharynx. head   WBbt:0005739

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000135 amt-3 M195.3 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023