WormMine: ExpressionPattern Expr7032

• Pattern: Adult Expression: intestine; unidentified cells in head; Larval Expression: intestine; unidentified cells in head
• Primary Identifier: Expr7032
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10042
• Reporter Gene: [abt-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCATTTGTTGTTTGTTGTT] 3' and primer B 5' [gattttcaagaaagccgattg] 3'.

2 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
anterior-most body region containing the pharynx.	head		WBbt:0005739

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00000023	abt-5	Y53C10A.9	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023