WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  GST-44::GFP localizes throughout the cytoplasm of the excretory cell. 5'upstream : 5'-cattgttgggcgttgaggtag, 5' nested : 5'ctgaaaaataatttggtttatg, 3' fusion primer: 5'AGTCGACCTGCAGGCATGCAAGCTcaagccataatcaaaatatggc. --precise ends. Primary Identifier  Expr2811
Subcellular Localization  cytoplasm
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001792 gst-44 F13A7.10 Caenorhabditis elegans

0 Life Stages