WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

RNAi :

WormBase ID  WBRNAi00114456 Genotype  GFP-histone H2B; GFP-gamma-tubulin
Phenotype Remark  quoted from paper: "The spindle poles rapidly and prematurely separated, and no anaphase chromosome segregation was observed (Fig. 1A, 200/210-sec panels)." Remark  knl-1 (WBGene00002231) RNAi; primer 1: ccatgctaatgtcttcacacg, primer 2: ccgctgaaatggatacgagt, amplified from N2 genomic DNA

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Inhibits Gene

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00002231 knl-1 C02F5.1 Caenorhabditis elegans

1 Inhibits Predicted Gene

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C02F5.1 C02F5.1 3033   III: 8250636-8250781

0 Laboratories

1 Phenotype

Identifier Name Description
WBPhenotype:0001378 mitotic chromosome segregation variant Any variation in the cell cycle process whereby replicated homologous chromosomes are organized and then physically separated and apportioned to two sets during the mitotic cell cycle compared to control animals.

0 Phenotype _ Not _ Observed

1 Reference

First Author Title Year Journal Volume Pages PubMed ID
            WBPaper00006142

0 Strain