WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

RNAi :

WormBase ID  WBRNAi00114455 Genotype  GFP-histone H2B; GFP-gamma-tubulin
Phenotype Remark  quoted from paper: "In KNL-1-depleted embryos, chromosomes derived from each of the pronuclei (sperm or oocyte) clumped together, resulting in two DNA masses positioned midway between the two spindlepoles (Fig. 1A, 120/130-sec panels)." Remark  knl-1 (WBGene00002231) RNAi; primer 1: ccatgctaatgtcttcacacg, primer 2: ccgctgaaatggatacgagt, amplified from N2 genomic DNA

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Inhibits Gene

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00002231 knl-1 C02F5.1 Caenorhabditis elegans

1 Inhibits Predicted Gene

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C02F5.1 C02F5.1 3033   III: 8250636-8250781

0 Laboratories

1 Phenotype

Identifier Name Description
WBPhenotype:0001348 chromosome morphology variant Variations in the form or composition of a structure in the cell nucleus which contains the genetic material encoded as DNA and surrounded by histone proteins and other regulatory elements compared to control. In C. elegans the normal cell contains 5 pairs of 'autosomes' and one or two X chromosomes (Wormatlas).

0 Phenotype _ Not _ Observed

1 Reference

First Author Title Year Journal Volume Pages PubMed ID
            WBPaper00006142

0 Strain