WormMine: Gene WBGene00000112

• WormBase Gene ID: WBGene00000112
• Gene Name: alh-6
• Sequence Name: F56D12.1
• Brief Description: alh-6 is orthologous to the human gene ALDEHYDE DEHYDROGENASE 4 FAMILY, MEMBER A1 (ALDH4A1; OMIM:606811), which when mutated leads to hyperprolinemia type II.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable 1-pyrroline-5-carboxylate dehydrogenase activity. Predicted to be involved in proline catabolic process to glutamate. Predicted to be located in mitochondrial matrix. Expressed in head and tail. Human ortholog(s) of this gene implicated in hyperprolinemia type 2. Is an ortholog of human ALDH4A1 (aldehyde dehydrogenase 4 family member A1).
• Biotype: SO:0001217
• Genetic Position: II :-15.5079 ±0.004302
• Length (nt): 3894

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000112

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F56D12.1a.2	F56D12.1a.2	1936	II: 1306240-1310133
Transcript:F56D12.1a.1	F56D12.1a.1	1837	II: 1306243-1309754
Transcript:F56D12.1b.1	F56D12.1b.1	2402	II: 1306245-1309753
Transcript:F56D12.1d.1	F56D12.1d.1	1272	II: 1306385-1309002
Transcript:F56D12.1c.1	F56D12.1c.1	1185	II: 1307467-1309751

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F56D12.1a	F56D12.1a	1692	II: 1306385-1306601
CDS:F56D12.1b	F56D12.1b	1539	II: 1307106-1307507
CDS:F56D12.1c	F56D12.1c	1185	II: 1307467-1307514
CDS:F56D12.1d	F56D12.1d	1272	II: 1306385-1306601

13 RNAi Result

• WBRNAi00093607
• WBRNAi00093601
• WBRNAi00048688
• WBRNAi00026880
• WBRNAi00027540
• WBRNAi00015810
• WBRNAi00021150
• WBRNAi00071772
• WBRNAi00090927
• WBRNAi00093614
• WBRNAi00071118
• WBRNAi00106487
• WBRNAi00111605

200 Allele

• gk964317
• gk963801
• h16636
• WBVar01603062
• WBVar01603063
• WBVar01435889
• WBVar01435883
• WBVar01435884
• gk133446
• gk133444
• gk133445
• gk133453
• gk133454
• gk133451
• gk133452
• gk133449
• gk133450
• gk133447
• gk133448
• gk133455
• gk133456
• gk133443
• WBVar01546122
• WBVar01546123
• WBVar01546124
• otn2680
• WBVar00038396
• WBVar01360207
• WBVar00038401
• gk358940

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000112
• Start: 1306240
• End: 1310133
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_1306137..1306239
• Length (nt): 103
• Chromosome Location: II: 1306137-1306239
• Organism: Caenorhabditis elegans

150 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Transgeneration hypoxia treatment.	Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage.	For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR.	WBPaper00064871:hypoxia_upregulated_F1
	Transcripts that showed significantly decreased expression in N2 day 5 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS).	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day5_vs_Day1_downregulated_Nanopore
	Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day7_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS).	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day7_vs_Day1_downregulated_Nanopore
	Transcripts that showed significantly decreased expression in N2 day 10 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq.	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day10_vs_Day1_downregulated_Illumina
	Transcripts that showed significantly decreased expression in N2 day 10 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS).	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day10_vs_Day1_downregulated_Nanopore
	Transcripts that showed significantly decreased expression in N2 day 15 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS).	DESeq fold change > 2, FDR < 0.05.	WBPaper00067499:Day15_vs_Day1_downregulated_Nanopore
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated

7 Expression Patterns

• Primary Identifier: Expr2009308
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6220
• Remark: Strain: BC11475
• Reporter Gene: [alh-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGATGGCTTGCAGATGACA] 3' and primer B 5' [TGCAAAAATGAGAATAAAATGAGC] 3'.
• Pattern: Adult Expression: body wall muscle; hypodermis; unidentified cells in head; unidentified cells in tail ; Larval Expression: body wall muscle; hypodermis; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr1030059
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1152446
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2027544
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1568
• Remark: Original chronogram file: chronogram.438.xml
• Reporter Gene: [F56D12.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1014020
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

14 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000112
• Start: 1306240
• End: 1310133
• Strand: -1

14 Ontology Annotations

4 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in alh-6(lax105) comparing to in N2 at 3-days post L4 adult hermaphrodite stage.	Differential expression analysis of two conditions was performed using DESeq R package (1.18.0). Resulting p-values were adjusted using Benjamini and Hochberg's approach. WormBase curator applied additional cut off of fold change > 2.	WBPaper00059231:alh-6(lax105)_D3Adult_upregulated
	Transcripts that showed significantly increased expression in alh-6(lax105) comparing to in N2 at L4 larva stage.	Differential expression analysis of two conditions was performed using DESeq R package (1.18.0). Resulting p-values were adjusted using Benjamini and Hochberg's approach. WormBase curator applied additional cut off of fold change > 2.	WBPaper00059231:alh-6(lax105)_L4_upregulated
	Transcripts that showed significantly decreased expression in alh-6(lax105) comparing to in N2 at L4 larva stage.	Differential expression analysis of two conditions was performed using DESeq R package (1.18.0). Resulting p-values were adjusted using Benjamini and Hochberg's approach. WormBase curator applied additional cut off of fold change > 2.	WBPaper00059231:alh-6(lax105)_L4_downregulated
	Transcripts that showed significantly decreased expression in alh-6(lax105) comparing to in N2 at 3-days post L4 adult hermaphrodite stage.	Differential expression analysis of two conditions was performed using DESeq R package (1.18.0). Resulting p-values were adjusted using Benjamini and Hochberg's approach. WormBase curator applied additional cut off of fold change > 2.	WBPaper00059231:alh-6(lax105)_D3Adult_downregulated

1 Sequence

• Length: 3894

1 Sequence Ontology Term

• Name: gene

0 Strains

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_1310134..1310514
• Length (nt): 381
• Chromosome Location: II: 1310134-1310514
• Organism: Caenorhabditis elegans