Genomics
4 Transcripts
Class | WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|---|
NcPrimaryTranscript | Transcript:F16B4.8d | F16B4.8d |
1526
![]() |
V: 1567076-1584934 |
MRNA | Transcript:F16B4.8a.1 | F16B4.8a.1 |
2088
![]() |
V: 1577691-1585532 |
MRNA | Transcript:F16B4.8b.1 | F16B4.8b.1 |
1963
![]() |
V: 1582779-1585520 |
MRNA | Transcript:F16B4.8c.1 | F16B4.8c.1 |
1122
![]() |
V: 1583396-1584934 |
Other
3 CDSs
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
CDS:F16B4.8a | F16B4.8a |
1443
![]() |
V: 1577738-1577795 |
CDS:F16B4.8b | F16B4.8b |
1377
![]() |
V: 1582779-1582883 |
CDS:F16B4.8c | F16B4.8c |
1122
![]() |
V: 1583396-1583866 |
25 RNAi Result
449 Allele
Public Name |
---|
WBVar01860496 |
WBVar01584620 |
WBVar01584621 |
WBVar01584622 |
WBVar01584623 |
WBVar01584624 |
WBVar01584625 |
WBVar01584626 |
WBVar01584627 |
WBVar01584617 |
WBVar01584618 |
WBVar01584619 |
gk963591 |
gk963553 |
gk964259 |
gk963850 |
gk963899 |
gk963027 |
s819 |
s1613 |
s1666 |
WBVar01971090 |
WBVar01971091 |
WBVar01971092 |
WBVar01971093 |
WBVar01971098 |
WBVar01971099 |
WBVar01971094 |
WBVar01971095 |
WBVar01971096 |
1 Chromosome Location
Feature . Primary Identifier |
Start | End | Strand |
---|---|---|---|
WBGene00000387 | 1567076 | 1585532 | 1 |
4 Data Sets
Name | URL |
---|---|
WormBaseAcedbConverter | |
GO Annotation data set | |
C. elegans genomic annotations (GFF3 Gene) | |
Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
---|---|---|---|---|---|
intergenic_region_chrV_1585533..1585710 | 178 | V: 1585533-1585710 | Caenorhabditis elegans |
214 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Genes with expression altered >= 3-fold in dpy-10(e128) mutants. | Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). | WBPaper00035873:dpy-10_regulated | |
Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. | DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. | WBPaper00060811:L1_vs_adult_upregulated_neural | |
Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. | Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. | WBPaper00045420:fertilization_downregulated_transcript | |
Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_NoFood |
Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin-Allantoin_upregulated | |
Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin_upregulated | |
Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). | DESeq2, fold change >= 2, FDR <= 0.01. | WBPaper00056826:SGP_biased | |
Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Psora-Allantoin_upregulated | |
Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rapamycin-Metformin_upregulated | |
Genome-wide analysis of developmental and sex-regulated gene expression profile. | self-organizing map | cgc4489_group_18 | |
Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141) | |
Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141) | |
Bacteria diet: Escherichia coli HB101. Fed for 30 generations. | Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50. | DESeq2 fold change > 2, p-value < 0.01. | WBPaper00061007:HB101_downregulated |
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations. | Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50. | DESeq2 fold change > 2, p-value < 0.01. | WBPaper00061007:S.aquatilis_downregulated |
Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h |
Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h |
Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h |
Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h |
Transcripts that showed significantly decreased expression in skn-1gf(lax188) comparing to in N2 animals at L4 stage fed with OP50 and exposed to PA14 for 4 hours. | DESeq2, FDR < 0.05, fold change > 2. | WBPaper00067255:skn-1(lax188)_downregulated_PA | |
Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation). | CuffDiff2 | WBPaper00051265:F4_hrde-1(tm1200)_upregulated |
10 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Expr2009780 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
Also expressed in (comments from author) : No comments. Strain: BC14937 | [cdc-25.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGGTTTATGATCGTTTGCCA] 3' and primer B 5' [ATGACTGTGCCCACGTGTT] 3'. | Expr5775 | Adult Expression: pharynx; intestine; rectal gland cells; Nervous System; pharyngeal neurons; Larval Expression: pharynx; intestine; rectal gland cells; Reproductive System; developing vulva; Nervous System; ventral nerve cord; pharyngeal neurons; | |
Expr1030211 | Tiling arrays expression graphs | |||
Expr13197 | Expression of Pcdc-25.2::gfp was observed in seam cells during the male larval developmental stages. Furthermore, the Pcdc-25.2::gfp signals were broadly expressed throughout development in multiple male somatic tissues, including pharynx, ventral nerve cord, body muscles, diagonal muscles, nervous system, and hypodermis. | |||
Picture: Fig 1A. | Expr8942 | cdc-25.2 mRNA was hardly detectable in glp-1(q224) hermaphrodites compared with N2 hermaphrodites, indicating that cdc-25.2 is preferentially expressed in the germ line. In N2 hermaphrodites, expression of cdc-25.2 mRNA was relatively low until L4 larval stage, but the expression increased significantly in young adult (YA; just after the L4 to adult molting but before egg laying has started) and adult (Ad; egg-laying gravid adult worms) stages, when oogenesis actively occurs in hermaphrodite worms. Furthermore, although cdc-25.2 mRNA was expressed in feminized fem-1(hc17lf) hermaphrodites, it was barely detectable in N2 males and in masculinized fem-3(q20gf) hermaphrodites. These results indicate that cdc-25.2 is expressed primarily in oocytes and not in sperm. However, compared with the robust expression in the N2 hermaphrodite germ line, the expression was much weaker in the feminized fem-1(lf) germ line, suggesting that the presence of sperm or fertilization positively affect the cdc-25.2 expression level. In conclusion, quantitative real-time RT-PCR showed that cdc-25.2 is predominantly expressed in oocytes of adult hermaphrodites. | ||
Expr12938 | cdc-25.2 mRNA was expressed in the intestine at the L1 stage. In contrast, a cdc-25.2 mRNA signal was not detected in the L2- to L3-stage larvae, but reappeared after the L4 stage in the gonad. These results indicate that cdc-25.2 is transiently expressed in the intestine at the L1 stage. | |||
Expr16199 | We found that not only the cdc-25.1 and cdc-25.2 genes but also the cdc-25.3 and cdc-25.4 genes were preferentially expressed in the germline. | |||
Expr2028020 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
Expr1148759 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
Expr1014180 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
19 GO Annotation
Annotation Extension | Qualifier |
---|---|
enables | |
enables | |
enables | |
enables | |
enables | |
enables | |
acts_upstream_of_or_within | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
enables | |
enables | |
located_in | |
located_in | |
involved_in | |
involved_in |
12 Homologues
Type |
---|
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
19 Ontology Annotations
Annotation Extension | Qualifier |
---|---|
enables | |
enables | |
enables | |
enables | |
enables | |
enables | |
acts_upstream_of_or_within | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
enables | |
enables | |
located_in | |
located_in | |
involved_in | |
involved_in |
1 Upstream Intergenic Region
WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
---|---|---|---|---|---|
intergenic_region_chrV_1558146..1567075 | 8930 | V: 1558146-1567075 | Caenorhabditis elegans |