WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00000388 Gene Name  cdc-25.3
Sequence Name  ? ZK637.11 Brief Description  cdc-25.3 encodes a tyrosine phosphatase that is a member of the cell division cycle 25 (CDC25) family of cell cycle regulators that includes Schizosaccharomyces pombe CDC25 and Drosophila string; cdc-25.3 is one of four cdc-25 genes in C. elegans and while it is known to be expressed in hermaphrodites, the precise function of cdc-25.3 is not yet clear; cdc-25.3 may function redundantly with cdc-25.2 during embryonic development and redundantly with cdc-25.1, cdc-25.2, and emb-29 during meiosis.
Organism  Caenorhabditis elegans Automated Description  Predicted to enable protein tyrosine phosphatase activity. Predicted to be involved in G2/M transition of mitotic cell cycle; positive regulation of G2/M transition of mitotic cell cycle; and positive regulation of G2/MI transition of meiotic cell cycle. Located in nucleus. Expressed in ABa; ABp; and germ line. Human ortholog(s) of this gene implicated in several diseases, including autosomal recessive polycystic kidney disease; endometrial hyperplasia; and reproductive organ cancer (multiple). Is an ortholog of human CDC25A (cell division cycle 25A); CDC25B (cell division cycle 25B); and CDC25C (cell division cycle 25C).
Biotype  SO:0001217 Genetic Position  III :0.040793 ±0.003949
Length (nt)  ? 1579
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00000388

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:ZK637.11.1 ZK637.11.1 1138   III: 8916351-8917929
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:ZK637.11 ZK637.11 951   III: 8916504-8916983

6 RNAi Result

WormBase ID
WBRNAi00059581
WBRNAi00059582
WBRNAi00022096
WBRNAi00005830
WBRNAi00038381
WBRNAi00110768

25 Allele

Public Name
gk964518
gk963887
gk840568
gk335505
gk427973
gk760048
gk866020
gk508514
gk582965
gk605636
gk405092
gk831442
gk181064
gk181066
gk181065
gk181071
ok358
ok221
gk181068
gk181067
gk181070
gk181069
WBVar00067120
tn1712
WBVar00067125

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00000388 8916351 8917929 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

205 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L1-larva_expressed
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_N2
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
Bacteria diet: Escherichia coli HB101. Fed for 30 generations. Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50. DESeq2 fold change > 2, p-value < 0.01. WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations. Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50. DESeq2 fold change > 2, p-value < 0.01. WBPaper00061007:S.aquatilis_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. 16 hours of exposure after L4 larva stage at 25C. Transcripts that showed significantly decreased expression in N2 animals fed by E. faecalis strain OG1RF for 16 hours after L4 larva stage at 25C. DESeq2, fold change > 2. WBPaper00061081:E.faecalis_downregulated_N2
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
  Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage. EdgeR, fold change > 2, FDR < 0.001. WBPaper00056290:hsp-6(mg585)_downregulated
  Transcripts that showed significantly decreased expression in skn-1gf(lax188) comparing to in N2 animals at L4 stage fed with OP50 and exposed to PA14 for 4 hours. DESeq2, FDR < 0.05, fold change > 2. WBPaper00067255:skn-1(lax188)_downregulated_PA
  Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage. DEseq2, fold change > 2 WBPaper00064505:tamoxifen_upregulated
  Transcripts that showed significantly decreased expression in miR-80(nDf53) comparing to in N2. EdgeR fold change > 2, FDR < 0.05. WBPaper00067295:miR-80(nDf53)_downregulated
  Transcripts that showed signifcantly increased expression in pabp-2(RNAi) animals comparing to in N2 animals injected with empty vector at L1 larva stage and collected at L4 larva stage. FDR < 0.05, fold change > 2 WBPaper00067368:pabp-2(RNAi)_upregulated_N2
  Transcripts that showed significantly increased expression in eat-2(ad465);dve-1(RNAi) animals comparing to eat-2(ad465) animals injected with empty vector. fold change > 2, FDR < 0.01 WBPaper00067391:dve-1(RNAi)_upregulated_eat-2(ad465)
Bacteria infection: Staphylococcus aureus Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals not colonized by microbiota and not infected by pathogen. DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05. WBPaper00067479:Microbiota-Pathogen_vs_control_downregulated
Bacteria infection: Staphylococcus aureus Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals colonized by microbiota but not infected by pathogen. DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05. WBPaper00067479:Microbiota-Pathogen_vs_Microbiota_downregulated
Heat Shock: 35C 4 hours at L4 larva stage. Transcripts that showed significantly decreased expression after L4 larva N2 animals were heat stressed at 35C for 4 hours DESeq2 WBPaper00057154:HeatShock_downregulated_mRNA
  Genes down regulated by mir-243(n4759). RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243. WBPaper00036130:mir-243_down_regulated
25C vs. 20C Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C. CuffDiff, fold change > 2. WBPaper00065096:25C_vs_20C_upregulated
  Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C. CuffDiff, fold change > 2. WBPaper00065096:Day10_vs_Day1_upregulated
  Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite npr-8(ok1439) animals grown at 20C, comparing to in N2 animals. CuffDiff, fold change > 2. WBPaper00065096:npr-8(ok1439)_upregulated_Day1_20C
  Transcripts that showed significantly decreased expression in npr-8(ok1439) animals with 24 hour exposure to P. aeruginosa PA14, comparing to N2 animals with 24 hour exposure to P. aeruginosa PA14. DESeq2, fold change > 1.5, FDR < 0.05. WBPaper00058948:npr-8(ok1439)_downregulated_PA14
  Genes with increased RNA expression after 24 hours rotenone treatment EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed. WBPaper00044426:rotenone_24h_upregulated

12 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr1162998 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2009781 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1019319 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1030212 Tiling arrays expression graphs  
Also expressed in (comments from author) : expression only in embryo Strain: BC10527 [cdc-25.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGGAAGACGTCGCCTTTTTAG] 3' and primer B 5' [TCAACGCAGATCAGGAGACTT] 3'. Expr7234    
Strain: BC12401 [cdc-25.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGGAAGACGTCGCCTTTTTAG] 3' and primer B 5' [TCAACGCAGATCAGGAGACTT] 3'. Expr7233    
    Expr16200 We found that not only the cdc-25.1 and cdc-25.2 genes but also the cdc-25.3 and cdc-25.4 genes were preferentially expressed in the germline.  
    Expr16342 CDC-25.3::GFP signal detected at 4-cell stage in ABa/ABp. Using our AF correction method, we were able to observe clear nuclear localization already at the start of the four-cell stage and accurately track its accumulation and release at NEBD at a time at which AF almost completely masked its expression in uncorrected images.  
    Expr2028021 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr13404 cdc-25.3 mRNA is highly expressed in N2 hermaphrodites at the young-adult stage, when oogenesis actively occurs, and in feminized fem-1(lf) hermaphrodites, but not in adult males or in masculinized fem-3(gf) hermaphrodites. These results indicate that cdc-25.3 is preferentially expressed during oogenesis.  
    Expr13391 GFP::3xFLAG::CDC-25.3 CDC-25.3 was expressed in early embryos but not oocytes. In wild-type embryos, CDC-25.3 expression is found in the cytoplasm and nuclei, depending on the embryonic and cell-cycle stage. GFP::3xFLAG::CDC- 25.3 is not detected in the distal proliferative zone (pz) or in meiotic germ cells in the adult stage.  
Original chronogram file: chronogram.325.xml [ZK637.11:gfp] transcriptional fusion. Chronogram1448    

17 GO Annotation

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  involved_in
  enables
  enables
  located_in
  located_in
  located_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables

12 Homologues

Type
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00000388 8916351 8917929 -1

17 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  involved_in
  enables
  enables
  located_in
  located_in
  located_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
1579

1 Sequence Ontology Term

Identifier Name Description
gene  

3 Strains

WormBase ID
WBStrain00031390
WBStrain00002130
WBStrain00001389

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_8917930..8920083   2154 III: 8917930-8920083 Caenorhabditis elegans