WormMine: Gene WBGene00000396

• WormBase Gene ID: WBGene00000396
• Gene Name: cdh-4
• Sequence Name: F25F2.2
• Brief Description: cdh-4 encodes a Fat-like cadherin homolog; CDH-4 is required for axon fasciculation, cell migration, and hypodermis and pharyngeal development; in addition, CDH-4 functions together with the FMI-1 flamingo-like cadherin to regulate development of the GABAergic VD motorneurons; cdh-4 is widely expressed beginning early in development, but by the L3 larval stage expression is confined to the VD GABAergic motorneurons.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable calcium ion binding activity. Predicted to be involved in homophilic cell adhesion via plasma membrane adhesion molecules. Predicted to be located in membrane. Expressed in several structures, including QL; QR; VD neuron; non-striated muscle; and rectal gland cell. Human ortholog(s) of this gene implicated in carcinoma (multiple); colorectal cancer; and spinocerebellar ataxia 45. Is an ortholog of human FAT1 (FAT atypical cadherin 1); FAT2 (FAT atypical cadherin 2); and FAT3 (FAT atypical cadherin 3).
• Biotype: SO:0001217
• Genetic Position: III :-3.14046 ±0.002997
• Length (nt): 16638

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000396

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F25F2.2.1	F25F2.2.1	13422	III: 4520357-4536994

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F25F2.2	F25F2.2	12987	III: 4520459-4520695

10 RNAi Result

• WBRNAi00107683
• WBRNAi00045516
• WBRNAi00066038
• WBRNAi00013880
• WBRNAi00087905
• WBRNAi00005086
• WBRNAi00091980
• WBRNAi00091982
• WBRNAi00091981
• WBRNAi00091983

241 Allele

• otn11048
• otn11049
• otn11050
• otn11051
• otn9735
• otn9736
• otn9737
• otn9738
• otn9739
• otn9740
• otn9741
• gk312566
• WBVar01445325
• gk778596
• otn13065
• otn13067
• otn13066
• otn13068
• WBVar01263094
• WBVar01263096
• WBVar01263097
• WBVar01263091
• WBVar01263092
• WBVar01263093
• otn2943
• otn2942
• gk917477
• gk419989
• gk419990
• gk588013

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000396
• Start: 4520357
• End: 4536994
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_4536995..4537280
• Length (nt): 286
• Chromosome Location: III: 4536995-4537280
• Organism: Caenorhabditis elegans

210 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly decreased expression in skn-1gf(lax188) comparing to in N2 animals at L4 stage fed with OP50 and exposed to PA14 for 4 hours.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00067255:skn-1(lax188)_downregulated_PA
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage.	DEseq2, fold change > 2	WBPaper00064505:tamoxifen_upregulated
Bacteria infection: Staphylococcus aureus	Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals not colonized by microbiota and not infected by pathogen.	DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05.	WBPaper00067479:Microbiota-Pathogen_vs_control_downregulated
Bacteria infection: Staphylococcus aureus	Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals colonized by microbiota but not infected by pathogen.	DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05.	WBPaper00067479:Microbiota-Pathogen_vs_Microbiota_downregulated
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Significantly differentially expressed genes as determined by microarray analysis of wild-type and cde-1 mutant germlines.	RNAs that changed at least 2-fold with a probability of p < 0.05 were considered differentially regulated between wildtype and cde-1.	WBPaper00035269:cde-1_regulated
	Transcripts that showed significantly increased expression after exposure to 75uM paraquat(PQ) from L1 to day 2 adult stage in skn-1(lax188) animals	fold change > 2	WBPaper00058711:paraquat_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated

11 Expression Patterns

• Primary Identifier: Expr2009802
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5857
• Remark: Also expressed in (comments from author) : No comments. Strain: BC16095
• Reporter Gene: [cdh-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTTTTCTGAATCTACTTTGAGG] 3' and primer B 5' [ACCCGATGTTTCTTGATTATTTTT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; rectal epithelium; Reproductive System; distal tip cell; uterine muscle; vulval muscle; vulva other; excretory cell; Nervous System; head neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; excretory cell; Nervous System; head neurons

• Primary Identifier: Expr1030217
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr8044
• Remark: Picture: Figure 6.
• Pattern: Strong expression could be observed in the embryo already before elongation and continuing throughout development. The number of GFP positive cells increases between the end of gastrulation and the 2-fold stage when a large number of cells in the head including neurons, hypodermal cells and the pharyngeal primordium express GFP. Outside the head region expression is obvious in all embryonic motoneurons in the ventral cord and in rectal epithelial cells, gland cells and the anal depressor and intestinal muscle in the tail. The expression persisted through all larval stages, most prominently in pharyngeal muscle cells. In adult animals cdh-4::GFP was also expressed in the reproduction system namely the spermatheca, the vulva and uterine muscles and the distal tip cells (DTC).

• Primary Identifier: Expr3896
• Pattern: Expressed in intestinal muscles, vm1, pm8, head neurons, spermatheca and rectal epithelial cells.

• Primary Identifier: Expr14864
• Pattern: We also used smFISH to examine the expression of cdh-4 and cdh-3. Consistent with transgenic reporter studies (Sundararajan et al., 2014), we observed cdh-4 mRNA spots in the Q neuroblasts, as well as a wide range of other cells, including the neighboring seam and P cells, ventral nerve cord neurons and cells in the head region. In contrast, we found that during the initial polarization and migration phase, cdh-3 was specifically expressed in the Q neuroblasts, with additional expression only in a few unidentified cells in the head. Similar to unc-40, there was no significant difference in expression between QL and QR. Moreover, for both cdh-3 and cdh-4, the expression level correlated with migration distance (cdh-3 QL, Spearman r = 0.5765, p < 0.0001, QR, Spearman r = -0.4838, p < 0.0004; cdh-4 QL, Spearman r = 0.3176, p < 0.03, QR, Spearman r = -0.5070, p < 0.0004), indicating that expression increases during polarization and migration.

• Primary Identifier: Expr10009
• Pattern: As has been described, cdh-4 is broadly expressed, including in motorneurons, starting early in development (Schmitz et al., 2008). However, we found that by the L3 stage, the broad expression of Pcdh-4::gfp throughout the nervous system had ceased but expression continues, specifically in the GABAergic neurons.

• Primary Identifier: Expr2028042
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram725
• Remark: Original chronogram file: chronogram.1756.xml
• Reporter Gene: [F25F2.2:gfp] transcriptional fusion.

• Primary Identifier: Expr1149434
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1017989
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

28 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000396
• Start: 4520357
• End: 4536994
• Strand: 1

3 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 16638

1 Sequence Ontology Term

• Name: gene

5 Strains

• WBStrain00031956
• WBStrain00040005
• WBStrain00040029
• WBStrain00054849
• WBStrain00054848

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_4518436..4520356
• Length (nt): 1921
• Chromosome Location: III: 4518436-4520356
• Organism: Caenorhabditis elegans