WormMine

WS296

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00000418 Gene Name  ced-4
Sequence Name  ? C35D10.9 Brief Description  ced-4 encodes a novel protein; along with CED-3, CED-4 is required for the initiation of programmed cell death; accordingly, genetic analyses indicate that ced-3 and ced-4 function upstream of ced-1, ced-2, and nuc-1 in the programmed cell death pathway; in yeast two-hybrid experiments, and upon coexpression in mammalian cells, CED-4 interacts with CED-9, an anti-apoptotic BCL-2 homolog; coexpression of CED-4 and CED-9 results in redistribution of CED-4 from the cytosol to organellar membranes, suggesting that CED-9 may negatively regulate CED-4 activity by sequestering CED-4 to intracellular membranes.
Organism  Caenorhabditis elegans Automated Description  Enables several functions, including BH domain binding activity; peptidase activator activity; and small molecule binding activity. Involved in several processes, including muscle cell cellular homeostasis; positive regulation of proteolysis; and regulation of apoptotic process. Located in several cellular components, including cytoplasm; membrane; and nucleus. Part of caspase complex. Expressed in several structures, including germ line. Human ortholog(s) of this gene implicated in Parkinson's disease; lung non-small cell carcinoma; and pancreatic cancer. Is an ortholog of human APAF1 (apoptotic peptidase activating factor 1).
Biotype  SO:0001217 Genetic Position  III :-2.41734 ±0.002053
Length (nt)  ? 2847
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00000418

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C35D10.9b.1 C35D10.9b.1 1716   III: 4852325-4854957
Transcript:C35D10.9a.1 C35D10.9a.1 1864   III: 4852325-4855171
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C35D10.9b C35D10.9b 1716   III: 4852325-4852775
CDS:C35D10.9a C35D10.9a 1650   III: 4852325-4852775

30 RNAi Result

WormBase ID
WBRNAi00103807
WBRNAi00113304
WBRNAi00092401
WBRNAi00067805
WBRNAi00041991
WBRNAi00041993
WBRNAi00011665
WBRNAi00011666
WBRNAi00005607
WBRNAi00005620
WBRNAi00005866
WBRNAi00005887
WBRNAi00062690
WBRNAi00029584
WBRNAi00030245
WBRNAi00113075
WBRNAi00062149
WBRNAi00077445
WBRNAi00077444
WBRNAi00077446
WBRNAi00097657
WBRNAi00087816
WBRNAi00097917
WBRNAi00041992
WBRNAi00082290
WBRNAi00082292
WBRNAi00082294
WBRNAi00098040
WBRNAi00094927
WBRNAi00075915

57 Allele

Public Name
WBVar01656578
n1162
ok5628
n3040
bz404
WBVar01785640
gk173546
WBVar00602630
n2273
n2274
n3158
gk173547
tm3724
WBVar02007732
n3195
ot188
n1894
n1416
n3312
WBVar01995095
WBVar01995094
ot228
ot227
WBVar00059596
ot238
gk332544
gk630169
ot248
gk592651
gk365336

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00000418 4852325 4855171 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_4855172..4855217   46 III: 4855172-4855217 Caenorhabditis elegans

124 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_NoFood
  Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). DESeq2, fold change >= 2, FDR <= 0.01. WBPaper00056826:SGP_biased
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_N2
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Genes down regulated by mir-243(n4759). RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243. WBPaper00036130:mir-243_down_regulated
  Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C. CuffDiff, fold change > 2. WBPaper00065096:Day10_vs_Day1_upregulated
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage. DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05. WBPaper00066110:tetraploid_vs_diploid_downregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L2-larva_expressed
  Transcripts that were regulated by both set-6(ok2195) and baz-2(tm0235) at 2-day post L4 adult hermaphrodite stage. N.A. WBPaper00059356:set-6(ok2195)_baz-2(tm0235)_regulated
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
  Genes that showed increased expression after germline ablation comparing to un-ablated animals. The differential expression between germline-ablated versus gonad-ablated animals was computed via the functions makeContrasts and contrasts.fit in the limma package in R/Bioconductor. WBPaper00045571:germline-ablation_upregulated
  Transcripts that showed significantly decreased expression in the neurons of bcat-1(RNAi) animals at 5-days post L4 adult hermaphrodite stage, comparing to animals injected with empty vector. DESeq2. FDR < 0.05. WBPaper00060459:bcat-1(RNAi)_downregulated
  Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C. EdgeR, FDR < 0.05, fold change < 0.5. WBPaper00055971:nhl-2(ok818)_25C_upregulated
  Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background. DESeq2, FDR < 0.05 WBPaper00060683:hlh-11(ko1)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Germline-intrinsic transcripts. Comparisons were made between genotypes by subtracting the mean log value of one ratio from another, and the significance of the difference was evaluated using Student t-test for two populations. For the fem-3(gf) versus fem-1(lf) direct comparison, authors performed the same analysis, except they used a Students t-test for one population. Author chose a combination of a twofold difference with a t value exceeding 99% confidence (P < 0.01), because these criteria allowed the inclusion of essentially all genes that had previously been identified as germline-enriched in a wt/glp-4 hermaphrodite comparison. Additionally, requiring a twofold difference reduced false positives, as the number of genes with two-fold difference and a P<0.01 only included ~100 genes more than with P < 0.001, and almost all genes showed germline expression by in situ hybridization. [cgc6390]:intrinsic
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_downregulated

15 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC11960 [ced-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTAGGCCTCTCACATTCCTGT] 3' and primer B 5' [TGATGTTTTCGAAACAACGGT] 3'. Expr5438 Adult Expression: intestine; anal sphincter; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; Larval Expression: intestine; anal sphincter; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons;  
    Expr2009848 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1019651 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1030234 Tiling arrays expression graphs  
    Expr9700   CED-4 does not colocalize with mitochondria in germ cells. In addition, we found no embryonic cells where CED-4::GFP staining colocalized with mitochondria, and in all cells where CED-4 was detectable it localized around the nucleus. We found the same perinuclear CED-4::GFP localization by directly detecting CED-4 by GFP fluorescence in embryos, larvae and adult worms. CED-4 is expressed in the entire germ line, located primarily around the nucleus with additional much weaker granular structures occurring in the cytoplasm. We confirmed the perinuclear staining pattern we observed with a third independently generated CED-4 antibody, which specifically recognizes CED-4. The same predominantly perinuclear CED-4 localization pattern was observed following detection of the CED-4::GFP fusion protein.
    Expr9701   CED-4 appears to colocalize with mitochondria and CED-9 in secondary spermatocytes and spermatids. This CED-4 localization in spermatocytes and spermatids was observed with two independent CED-4 antibodies and by staining for CED-4::GFP.
    Expr13318 Low levels of ced-9 transcripts were found broadly.  
    Expr2028088 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr10591 Wild-type male germ cells expressed CED-4 late in spermatogenesis during the transition from secondary spermatocyte to mature spermatids, consistent with observations in fly and mouse testes (Cagan, 2003).  
    Expr12675    
    Expr1146001 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr15522   CED-4::GFP localized to late pachytene nuclei.
    Expr11814   Both CED-3 and CED-4 proteins localize in the pachytene region of wild-type worms.
    Expr12459   CED-4 dis- played the expected web-like cytoplasmic labeling in wild-type embryos, typical of mitochondrial localization.
    Expr1506 There are two transcripts, 2.2 kb and 0.9 kb. ced-4 (2.2 kb) is expressed primarily in embryos. The 0.9 kb transcript is expressed in eggs and adults.  

73 GO Annotation

Annotation Extension Qualifier
occurs in(GO:0048471) enables
  enables
  enables
occurs in(GO:0048471) enables
  enables
  enables
  enables
  enables
occurs in(GO:0048471) enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
occurs in(GO:0048471) enables
  enables
  enables
  enables
  enables

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00000418 4852325 4855171 1

73 Ontology Annotations

Annotation Extension Qualifier
occurs in(GO:0048471) enables
  enables
  enables
occurs in(GO:0048471) enables
  enables
  enables
  enables
  enables
occurs in(GO:0048471) enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
  enables
occurs in(GO:0048471) enables
  enables
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
2847

1 Sequence Ontology Term

Identifier Name Description
gene  

14 Strains

WormBase ID
WBStrain00022157
WBStrain00024083
WBStrain00026977
WBStrain00026975
WBStrain00026976
WBStrain00027054
WBStrain00027203
WBStrain00027238
WBStrain00027234
WBStrain00029436
WBStrain00029388
WBStrain00029395
WBStrain00029392
WBStrain00029383

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_4851911..4852324   414 III: 4851911-4852324 Caenorhabditis elegans