WormMine: Gene WBGene00000776

• WormBase Gene ID: WBGene00000776
• Gene Name: cpl-1
• Sequence Name: T03E6.7
• Brief Description: cpl-1 encodes a member of the cathepsin L-like cysteine protease family required for embryonic viability and normal growth; expressed in eggshells and throughout early embryos, accumulates in intestinal cells during late embryogenesis, and expressed in the cuticle, gonad, and pharynx later in development.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable cysteine-type endopeptidase activity. Involved in several processes, including lipid droplet disassembly; positive regulation of vitellogenesis; and regulation of apoptosis involved in tissue homeostasis. Located in several cellular components, including lysosome; vesicle lumen; and yolk granule. Expressed in several structures, including cuticle; eggshell; hermaphrodite gonad; pharynx; and vulva. Human ortholog(s) of this gene implicated in hypertrophic cardiomyopathy and type 2 diabetes mellitus. Is an ortholog of human CTSL (cathepsin L).
• Biotype: SO:0001217
• Genetic Position: V :10.72±
• Length (nt): 2775

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000776

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T03E6.7a.1	T03E6.7a.1	1190	V: 16592572-16595346
Transcript:T03E6.7b.1	T03E6.7b.1	597	V: 16592747-16593911

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T03E6.7a	T03E6.7a	1014	V: 16592747-16592955
CDS:T03E6.7b	T03E6.7b	597	V: 16592747-16592955

20 RNAi Result

• WBRNAi00086777
• WBRNAi00086778
• WBRNAi00086766
• WBRNAi00052275
• WBRNAi00026171
• WBRNAi00076635
• WBRNAi00093242
• WBRNAi00082128
• WBRNAi00009103
• WBRNAi00082129
• WBRNAi00111844
• WBRNAi00108498
• WBRNAi00082130
• WBRNAi00108775
• WBRNAi00086775
• WBRNAi00086776
• WBRNAi00089142
• WBRNAi00115199
• WBRNAi00108761
• WBRNAi00090674

188 Allele

• gk963271
• WBVar02123303
• WBVar02124908
• gk964050
• WBVar02123708
• WBVar02124497
• WBVar02124626
• WBVar02124059
• WBVar02121634
• gk963302
• WBVar02122684
• WBVar02124428
• WBVar02122859
• WBVar02121292
• WBVar02068848
• WBVar02068847
• WBVar00246044
• WBVar00246045
• WBVar01976509
• WBVar01976510
• WBVar02025114
• WBVar00039675
• ok360
• WBVar01593723
• WBVar01778179
• WBVar01778180
• WBVar01778177
• WBVar01778178
• WBVar01778183
• WBVar01778184

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000776
• Start: 16592572
• End: 16595346
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_16592320..16592571
• Length (nt): 252
• Chromosome Location: V: 16592320-16592571
• Organism: Caenorhabditis elegans

240 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
mitochondrial sulfide delivery molecule (mtH2S) AP39	Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from 1-day-post L4 until 11 days post L4.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:mtH2S-AP39-D0-treatment_upregulated_Day11
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h

17 Expression Patterns

• Primary Identifier: Expr6577
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11306
• Reporter Gene: [cpl-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAAAAATTGTTTTTGGGGGTCTT] 3' and primer B 5' [GAATCGGTTGATTCTGGAATTTTA] 3'.
• Pattern: Adult Expression: pharynx; intestine; hypodermis; Larval Expression: pharynx; intestine; hypodermis

• Primary Identifier: Expr1030480
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr181
• Remark: CPL, cysteine protease communicated by EMAIL : shashmi@nybc.org
• Pattern: Intense gfp expression was observed in the hypodermal region, posterior bulb of pharynx and vulval regions in all stages of the worm.

• Primary Identifier: Expr1777
• Pattern: CPL-1 was localized in various cells in early to late embryonic stages as well as in the eggshell surrounding the embryos. CPL-1 accumulated in numerous cells during early embryogenesis; however, as embryos progressed through middle and late developmental stages, the CPL-1 protein clustered in gut cells of the embryos at the early L1 stage. In addition, Ce-CPL-1 was present in the hypodermal and cuticular regions in all larval and adult stages, in the pharyngeal lining of all stages, and in the pharyngeal gland of the adult worms only.
• Subcellular Localization: The subcellular localization of the native CPL protein in C. elegans was determined by immunoelectron microscopy staining. In larval and adult stages the native protein was localized in the cuticular region of the worms and on the outer cuticle of the ridge of the annuli. In molting larvae, the protein was localized in both the old and new cuticle. In addition, the protein was localized on the surface of late-stage embryos.

• Primary Identifier: Expr7868
• Remark: Picture: Figure 2A, 2B.
• Pattern: The cpi-2a transcript was present throughout development; however, its expression varied between stages. Notably, the cpi-2a transcript increased ~2.5-3.5 h before each molt: the L1/L2 molt (11.5 h after hatching), the L2/L3 molt (18.5 h), the L3/L4 molt (26 h), and the L4/adult molt (36 h). Subsequent to each molt, the transcript levels decreased. Transcription levels of Ce-cpl-1 were also elevated before each molt and at the same times as those of Ce-cpi-2a. The decrease in the transcription levels after the L2/L3, L3/L4, and L4/adult was also similar, except that after the L1/L2 molt, the cpi-2a transcript went up, but the cpl-1 remained low. The elevated cpi-2a transcription profile before each molt also coincided with the C. elegans Ce-cpz-1 transcript levels but only before the L2/L3, L3/L4, and L4/adult molt, and the timing before the molt was 2 h.

• Primary Identifier: Expr450
• Pattern: By RT-PCR, level of expression increases approx. four hours prior to each moult. Returns to basal level after moult. High level expression in adults Gut specific expression in embryos

• Primary Identifier: Expr1775
• Remark: Identical staining patterns were observed using rol-6 or unc-76 rescue as a marker of transformation, indicating that any enhancer elements present in the marker gene did not influence the expression pattern.
• Pattern: Expression of the lacZ transcriptional fusion construct was detected in all developmental stages, from early embryos through to the adult stages. In embryos, beta-galactosidase expression was confined exclusively to gut cells. In larvae and adults, both hermaphrodites and males, strong expression was also detected in all gut cells. In addition, beta-galactosidase staining was also observed in hypodermal cells of many larval and adult transgenic worms, although the number of hypodermal cells showing expression and the level of expression was more mosaic than gut cell expression. Examination of transformants with high levels of hypodermal cell expression showed that all types of hypodermal cells, dorsal, lateral, and ventral cells, expressed the cpl-1:lacZ transgene.

• Primary Identifier: Expr10200
• Subcellular Localization: Wild-type CPL-1::YFP appeared as discrete puncta within intestinal cells and co-localized with the endolysosomal marker BSA::AlexaFluor647, but not with the ER-retained DsRed::KDEL.

• Primary Identifier: Expr4096
• Remark: Curated by authors based on online in-situ hybridization database (Y. Kohara, personal communication; http://nematode.lab.nig.ac.jp).
• Pattern: Expressed in intestine.

• Primary Identifier: Expr1776
• Remark: No GO_term assigned.
• Pattern: A distinct expression pattern in the hypodermal and cuticular regions of all stages was obtained from the Ce-cpl-1 translational fusion construct. Expression of the CPL-1::GFP fusion protein was also observed along the length of the pharyngeal lining in L1-L4 stages, but was restricted to the posterior bulb of the pharynx in adult worms. Furthermore, robust expression was observed in the eggshells surrounding the embryos inside the hermaphrodite and in the regions of the vulva, uterus, and spermatheca. In contrast to the transcriptional reporter construct there was no CPL-1::GFP expression in the gut.
• Subcellular Localization: GFP was detected in the eggshells of laid eggs in different stages of development.

• Primary Identifier: Expr11799
• Pattern: CPL-1::mChOint is expressed ubiquitously from embryos to adults, including in germline sheath cells and hypodermal cells, which function as engulfing cells for removing cell corpses.
• Subcellular Localization: CPL-1 is delivered to lysosomes. CPL-1 acts in phagolysosomes for cell corpse degradation.

• Primary Identifier: Expr2010492
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1155906
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1774
• Pattern: The sqRT-PCR demonstrated that cpl-1 levels increase about 4 h prior to molting.

• Primary Identifier: Expr1028037
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1767
• Remark: Original chronogram file: chronogram.682.xml
• Reporter Gene: [T03E6.7:gfp] transcriptional fusion.

• Primary Identifier: Expr2028732
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

27 GO Annotation

42 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000776
• Start: 16592572
• End: 16595346
• Strand: -1

27 Ontology Annotations

1 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in an integrated transgenic line expressing CPL-1(W32AY35A)-YFP under nhx-2 promoter comparing to in an integrated transgenic line expressing CPL-1(WT)-YFP under nhx-2 promoter.	The cut-off for filtering of upregulated constructs was performed with p-value <= 0.05.	WBPaper00064728:cpl-1(W32AY35A)_upregulated

1 Sequence

• Length: 2775

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00035678

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_16595347..16598888
• Length (nt): 3542
• Chromosome Location: V: 16595347-16598888
• Organism: Caenorhabditis elegans