WormMine: Gene WBGene00000875

• WormBase Gene ID: WBGene00000875
• Gene Name: cyk-4
• Sequence Name: K08E3.6
• Brief Description: cyk-4 encodes a Rho GAP (Rho guanosine triphosphatase (GTPase) activating protein); during development, cyk-4 is required for two different processes: 1) paternally provided CYK-4 regulates anterior-posterior polarity in the one-cell embryo by controlling the actomyosin cytoskeletal network, and 2) together with ZEN-4, CYK-4 is sufficient to promote formation of the large bundles of microtubules that form the central spindle during anaphase and polarize the foregut epithelium; in addition, CYK-4 is required for fertility and coordinated locomotion postembryonically; CYK-4 is enriched in sperm and also localizes to the central spindle during anaphase interdependently with ZEN-4; CYK-4 interacts with ZEN-4 in vitro and in vivo.
• Organism: Caenorhabditis elegans
• Automated Description: Enables GTPase activator activity. Involved in microtubule bundle formation involved in mitotic spindle midzone assembly; mitotic cleavage furrow ingression; and polar body extrusion after meiotic divisions. Located in mitotic spindle midzone and plasma membrane. Part of centralspindlin complex. Expressed in germ cell; gonad; and tail. Human ortholog(s) of this gene implicated in congenital dyserythropoietic anemia type IIIb. Is an ortholog of human RACGAP1 (Rac GTPase activating protein 1).
• Biotype: SO:0001217
• Genetic Position: III :21.5101 ±0.042376
• Length (nt): 2577

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000875

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:K08E3.6.1	K08E3.6.1	2200	III: 13768648-13771224

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:K08E3.6	K08E3.6	2046	III: 13768801-13769010

27 RNAi Result

• WBRNAi00107893
• WBRNAi00064013
• WBRNAi00000786
• WBRNAi00034135
• WBRNAi00073203
• WBRNAi00073205
• WBRNAi00073204
• WBRNAi00086665
• WBRNAi00086670
• WBRNAi00086674
• WBRNAi00006968
• WBRNAi00050286
• WBRNAi00085497
• WBRNAi00008974
• WBRNAi00080206
• WBRNAi00086691
• WBRNAi00071866
• WBRNAi00071385
• WBRNAi00050287
• WBRNAi00002625
• WBRNAi00107631
• WBRNAi00007706
• WBRNAi00025919
• WBRNAi00077871
• WBRNAi00086657
• WBRNAi00086661
• WBRNAi00080205

46 Allele

• gk963887
• gk963715
• gk963904
• gk963552
• WBVar00222514
• WBVar02123798
• gk962965
• ok1034
• WBVar00222515
• WBVar02124192
• WBVar02122322
• gk492673
• gk191203
• gk191204
• gk191201
• gk191202
• t1689
• xs76
• WBVar02120490
• gk578308
• gk436202
• gk837545
• gk492085
• gk524002
• gk779202
• xs78
• gk458657
• xs79
• h8324
• xs80

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000875
• Start: 13768648
• End: 13771224
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_13768093..13768647
• Length (nt): 555
• Chromosome Location: III: 13768093-13768647
• Organism: Caenorhabditis elegans

196 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed altered expression in cat-1(RNAi) animals comparing to control animals injected with empty vector.	p-value <= 0.05	WBPaper00066902:cat-1(RNAi)_regulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria diet: Escherichia coli HB101. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:hsp-6(mg585)_downregulated
starvation 12 hours	Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals.	EdgeR, FDR < 0.05, fold change >= 2.	WBPaper00067259:starvation_upregulated_intestine
	Top 300 transcripts enriched in ABalppppppa, ABpraaapppa according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:ASE_parent
	Transcripts that showed significantly increased expression after 24-hour exposure to 10uM benzyl butyl phthalate (BBP) in col-121(nx3) animals.	DESeq2v1.38.3, FDR < 0.05	WBPaper00067417:benzyl-butyl-phthalate_regulated
Transgeneration hypoxia treatment.	Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage.	For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR.	WBPaper00064871:hypoxia_upregulated_F1
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M

16 Expression Patterns

• Primary Identifier: Expr6362
• Remark: Strain: BC12415
• Reporter Gene: [cyk-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCGATAAATTGGACGGTATATT] 3' and primer B 5' [CTGGACTTGATTCTAAAATGTGGA] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; hypodermis; Larval Expression: pharynx; intestine; hypodermis; Nervous System; ventral nerve cord; tail neurons

• Primary Identifier: Expr6363
• Remark: Also expressed in (comments from author) : GFP expression in adults was much less than in the larvae. Strain: BC10601
• Reporter Gene: [cyk-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCGATAAATTGGACGGTATATT] 3' and primer B 5' [CTGGACTTGATTCTAAAATGTGGA] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: pharynx; intestine; hypodermis; seam cells; Nervous System; ventral nerve cord; head neurons; unidentified cells; unidentified cells in tail

• Primary Identifier: Expr1030541
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr10989
• Subcellular Localization: GFP::ZEN-4 localized specifically to the subregion of the germ cell membranes that separates each germ cell from the rachis, i.e., the rachis bridge. Localization to the rachis bridge was maintained throughout the gonad and into the proximal region until the point where the oocyte is formed and the rachis disappears. GFP::ZEN-4 also appeared on or in nuclei as the transition to oogenesis was initiated and remained associated with oocyte nuclei in the proximal gonad. CYK-4::GFP has the same localization pattern as GFP::ZEN-4.

• Primary Identifier: Expr9669
• Subcellular Localization: GFP:CYK-4 localized to the center of the meiotic anaphase spindle, only co-localizing with the central region of microtubules.

• Primary Identifier: Expr1153988
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2010658
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr3988
• Subcellular Localization: Antibody staining revealed that CYK-4 was dramatically enriched in sperm (64 out of 64 embryos examined). Inactivation of cyk-4 by RNA interference (RNAi) indicated that staining was specific and RNAi effective. Upon fertilization, CYK-4 could be detected at the posterior cortex of the one-cell embryo of both wild-type embryos and embryos lacking maternal CYK-4. Paternal CYK-4 was observed in punctate structures, derived from sperm membranous organelles (MOs) and often associated with the sperm pronucleus. Based on nuclear morphology, paternal CYK-4 remained associated with the cortex and MOs during meiosis and the onset of polarity, a period of about 30 min.

• Primary Identifier: Chronogram1437
• Remark: Original chronogram file: chronogram.315.xml
• Reporter Gene: [K08E3.6:gfp] transcriptional fusion.

• Primary Identifier: Expr942
• Remark: No detailed cellular pattern description.
• Subcellular Localization: CYK-4 accumulates on the central spindle before the initiation of furrowing. CYK-4 localized to the central spindle becomes compressed into a bright spot that persists at the division remnant. The remnant persists for several cell cycles, although instances were observed where the remnant (sometimes from the polar body) detaches from the cortex and is observed as a discrete spot in the cytoplasm.

• Primary Identifier: Expr12580
• Subcellular Localization: Centralspindlin, a complex containing ZEN-4 and the GTPase activating protein (GAP) CYK-4 (Mishima et al., 2002), localizes near the ingressing cleavage furrow as well as the spindle midzone.

• Primary Identifier: Expr1010772
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2028898
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr14748
• Subcellular Localization: WT CYK-4::mCherry localized to the rachis surface and was enriched in the rachis bridges; it was also present in nuclei, similar to mNeonGreen-tagged CYK-4.

• Primary Identifier: Expr16182
• Subcellular Localization: CYK-4 and ZEN-4 colocalize on the central spindle.

• Primary Identifier: Chronogram1625
• Remark: Original chronogram file: chronogram.506.xml
• Reporter Gene: [K08E3.6:gfp] transcriptional fusion.

29 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000875
• Start: 13768648
• End: 13771224
• Strand: -1

29 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2577

1 Sequence Ontology Term

• Name: gene

7 Strains

• WBStrain00036127
• WBStrain00007805
• WBStrain00007783
• WBStrain00002137
• WBStrain00007352
• WBStrain00007362
• WBStrain00001426

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_13771225..13771512
• Length (nt): 288
• Chromosome Location: III: 13771225-13771512
• Organism: Caenorhabditis elegans