WormMine: Gene WBGene00001187

• WormBase Gene ID: WBGene00001187
• Gene Name: egl-19
• Sequence Name: C48A7.1
• Brief Description: egl-19 encodes the pore-forming alpha1 subunit of a voltage-gated calcium channel orthologous to the alpha subunit of mammalian L-type calcium ion channels; EGL-19 carries L-type currents in pharyngeal and body wall muscle, and its activity is essential and required for muscle contraction during late embryonic morphogenesis, locomotion, egg laying, mating and feeding; recordings of voltage-dependent calcium currents indicate that EGL-19 is the sole C. elegans alpha1 voltage-gated calcium channel subunit to carry currents in body wall muscle and that these currents are regulated by the CCB-1 beta subunit and the UNC-36 alpha2/delta subunit; egl-19 is expressed in muscle cells and some neurons.
• Organism: Caenorhabditis elegans
• Automated Description: Enables voltage-gated calcium channel activity. Involved in several processes, including determination of left/right asymmetry in nervous system; positive regulation of striated muscle contraction; and regulation of nematode pharyngeal pumping. Located in plasma membrane. Expressed in several structures, including alimentary muscle; neurons; preanal ganglion; tail; and vulval muscle. Used to study Duchenne muscular dystrophy and Timothy syndrome. Human ortholog(s) of this gene implicated in several diseases, including Brugada syndrome 3; X-linked recessive disease (multiple); and muscle tissue disease (multiple). Is an ortholog of human CACNA1C (calcium voltage-gated channel subunit alpha1 C); CACNA1F (calcium voltage-gated channel subunit alpha1 F); and CACNA1S (calcium voltage-gated channel subunit alpha1 S).
• Biotype: SO:0001217
• Genetic Position: IV :3.33453 ±0.000859
• Length (nt): 13159

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001187

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C48A7.1b.1	C48A7.1b.1	6465	IV: 7405582-7418740
Transcript:C48A7.1a.1	C48A7.1a.1	6175	IV: 7405582-7418732
Transcript:C48A7.1c.1	C48A7.1c.1	723	IV: 7416211-7417909

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C48A7.1a	C48A7.1a	5352	IV: 7405582-7405588
CDS:C48A7.1b	C48A7.1b	5634	IV: 7405582-7405588
CDS:C48A7.1c	C48A7.1c	723	IV: 7416211-7416401

10 RNAi Result

• WBRNAi00089854
• WBRNAi00064260
• WBRNAi00002264
• WBRNAi00042705
• WBRNAi00008534
• WBRNAi00024850
• WBRNAi00089917
• WBRNAi00090077
• WBRNAi00090235
• WBRNAi00113903

212 Allele

• gk964500
• gk963722
• gk963417
• gk963416
• gk205417
• gk438893
• gk662816
• WBVar00190485
• gk852962
• gk205432
• gk753115
• gk498974
• st553
• st556
• st576
• st577
• st569
• st571
• WBVar02020875
• WBVar02020874
• gk946318
• gk946317
• gk946319
• WBVar01729830
• n582ad952
• WBVar01729833
• WBVar01729834
• WBVar01729831
• WBVar01729832
• WBVar00190477

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001187
• Start: 7405582
• End: 7418740
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_7418741..7419117
• Length (nt): 377
• Chromosome Location: IV: 7418741-7419117
• Organism: Caenorhabditis elegans

164 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
Fungi infection: Myzocytiopsis humicola	Transcripts that showed significantly altered expression 12 hours after animals were infected by M. humicola.	Differentially expressed genes as determined by Kallisto and Sleuth (pval<0.01, qval<0.1).	WBPaper00060871:M.humicola-infection_12h_regulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted

16 Expression Patterns

• Primary Identifier: Expr1030759
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr5534
• Remark: Strain: BC12759
• Reporter Gene: [egl-19::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCGTTGCACCCTTCTTG] 3' and primer B 5' [CCTGACATGATGGACACAGG] 3'.
• Pattern: Adult Expression: pharynx; intestine; hypodermis; amphid socket cells; unidentified cells in head; unidentified cells in tail ; Embryo Expression: intestine; Larval Expression: pharynx; intestine; hypodermis; amphid socket cells; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5535
• Remark: Also expressed in (comments from author) : No comment. Strain: BC12652
• Reporter Gene: [egl-19::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCGTTGCACCCTTCTTG] 3' and primer B 5' [CCTGACATGATGGACACAGG] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; intestine; rectal epithelium; hypodermis; seam cells; Larval Expression: pharynx; arcade cells; intestine; rectal epithelium; hypodermis; seam cells

• Primary Identifier: Expr5533
• Remark: Strain: BC10744
• Reporter Gene: [egl-19::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCGTTGCACCCTTCTTG] 3' and primer B 5' [CCTGACATGATGGACACAGG] 3'.
• Pattern: Adult Expression: pharynx; intestine; Nervous System; ventral nerve cord; head neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; hypodermis; Nervous System; ventral nerve cord; head neurons; unidentified cells in tail

• Primary Identifier: Expr16372

• Primary Identifier: Expr16373
• Subcellular Localization: possibly the cytosol

• Primary Identifier: Expr1458
• Pattern: In transgenic animals carrying the fusion gene, an egl-19::GFP fluorescent signal was first detected in body wall muscles in 11/2-fold embryos, before the onset of embryonic muscle contraction. By the time of hatching, GFP fluorescence was found in pharyngeal muscles pm3, pm4, pm5 and pm7, in body wall muscles and in the anal depressor muscle. Expression was also found in the nervous system, including the pharyngeal neuron M4 and several neurons in the head, the ventral nerve cord and the preanal ganglion.

• Primary Identifier: Expr12700
• Subcellular Localization: The single copy insertion transgenes showed that GFP::UNC-2, SLO-1::TagRFP, SLO-1::GFP, SLO-2::TagRFP, and GFP::EGL-19 were mainly localized on the plasma membrane of AWC cell bodies and also displayed a punctate pattern along AWC axons.

• Primary Identifier: Expr16371

• Primary Identifier: Expr2011210
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2029446
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1146697
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1013253
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1170007
• Pattern: Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191

• Primary Identifier: Chronogram1325
• Remark: Original chronogram file: chronogram.2571.xml
• Reporter Gene: [C48A7.1:gfp] transcriptional fusion.

• Primary Identifier: Chronogram185
• Remark: Original chronogram file: chronogram.1215.xml
• Reporter Gene: [C48A7.1:gfp] transcriptional fusion.

25 GO Annotation

25 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001187
• Start: 7405582
• End: 7418740
• Strand: 1

25 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 13159

1 Sequence Ontology Term

• Name: gene

34 Strains

• WBStrain00023532
• WBStrain00024343
• WBStrain00026816
• WBStrain00026871
• WBStrain00027247
• WBStrain00030918
• WBStrain00033523
• WBStrain00033420
• WBStrain00033423
• WBStrain00033424
• WBStrain00033421
• WBStrain00033422
• WBStrain00034472
• WBStrain00034471
• WBStrain00034475
• WBStrain00034474
• WBStrain00052850
• WBStrain00005514
• WBStrain00005533
• WBStrain00005526
• WBStrain00005527
• WBStrain00005528
• WBStrain00005532
• WBStrain00005534
• WBStrain00005530
• WBStrain00005531
• WBStrain00005537
• WBStrain00005503
• WBStrain00005535
• WBStrain00005536

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_7405507..7405581
• Length (nt): 75
• Chromosome Location: IV: 7405507-7405581
• Organism: Caenorhabditis elegans