WormMine: Gene WBGene00001752

• WormBase Gene ID: WBGene00001752
• Gene Name: gst-4
• Sequence Name: K08F4.7
• Brief Description: gst-4 encodes a putative glutathione-requiring prostaglandin D synthase;gst-4 is required for sperm to normally migrate towards a PUFA-basedsignal exuded by oocytes; gst-4(RNAi) hermaphrodites are infertile, boththrough aberrant loss of their own sperm and through failure of males toeffectively inseminate them; in mammalian eicosanoid signalling,prostaglandin D synthase is required for the conversion of prostaglandinH2 into D2; gst-4 mRNA is expressed in adults, and accumulationincreases in response to paraquat.
• Organism: Caenorhabditis elegans
• Automated Description: Enables glutathione transferase activity. Involved in glutathione metabolic process. Located in contractile muscle fiber. Expressed in body wall musculature; hypodermis; muscle cell; and pharynx.
• Biotype: SO:0001217
• Genetic Position: IV :4.53774 ±0.000625
• Length (nt): 875

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001752

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:K08F4.7.1	K08F4.7.1	731	IV: 10142225-10143099

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:K08F4.7	K08F4.7	624	IV: 10142240-10142372

12 RNAi Result

• WBRNAi00081486
• WBRNAi00050324
• WBRNAi00016832
• WBRNAi00027715
• WBRNAi00081536
• WBRNAi00087561
• WBRNAi00069796
• WBRNAi00081511
• WBRNAi00069819
• WBRNAi00115456
• WBRNAi00115523
• WBRNAi00090639

20 Allele

• gk964278
• gk964078
• gk964500
• gk962765
• otn668
• otn669
• gk210279
• gk210277
• gk210278
• gk210275
• gk210276
• ok2358
• WBVar01730587
• WBVar01730588
• gk321881
• gk719127
• gk789125
• gk652672
• tm3294
• WBVar01856671

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001752
• Start: 10142225
• End: 10143099
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

370 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults.	Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05.	WBPaper00061530:nhr-49(e2144)_downregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Fungi infection: Myzocytiopsis humicola	Transcripts that showed significantly altered expression 12 hours after animals were infected by M. humicola.	Differentially expressed genes as determined by Kallisto and Sleuth (pval<0.01, qval<0.1).	WBPaper00060871:M.humicola-infection_12h_regulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts that showed significantly decreased expression in prx-5(RNAi) animals.	Fold change > 2, p-value < 0.05.	WBPaper00060911:prx-5(RNAi)_downregulated_mRNA
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in Y56A3A.22(cck200) and Y56A3A.22(cck201) animals comparing to wild type animals.	N.A.	WBPaper00061045:Y56A3A.22(cck200)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly decreased expression in vit-2(ac3); zcIs4, comparing to parenting strain SJ4005 [zcIs4].	Differential gene expression analysis was then performed on normalized samples. Genes exhibiting at least twofold change and a false-discovery rate (FDR) of 1% or less were considered differentially expressed.	WBPaper00051305:vit-2(ac3)_downregulated
	mRNAs that showed increased expression in P-granule RNAi animales (simultaneously targeting pgl-1, pgl-3, glh-1 and glh-4) comparing to in control RNAi animals. Set 1 transcripts were defined as P-value < 0.05 and fold change > 2.	DESeq was used. Fold change between the average of the four control replicates and the average of the four test replicates was used to calculate the significance using a negative binomial distribution. An adjusted P-value was calculated using the Benjamini-Hochberg method for multiple testing correction.	WBPaper00046805:P-granule-RNAi_upregulated_Set1
	Transcripts that showed significantly increased expression in WD485[mpk-2(ok219)] comparing to in N2.	N.A.	WBPaper00056586:mpk-2(ok219)_upregulated
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2.	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_N2-background
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated

13 Expression Patterns

• Primary Identifier: Expr1031043
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6369
• Remark: Strain: BC13348
• Reporter Gene: [gst-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCATTTCCAACGATAATTCG] 3' and primer B 5' [TGAATCGATGTATCAATTGTTTT] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; Nervous System; head neurons; Larval Expression: pharynx; Nervous System; head neurons

• Primary Identifier: Expr2612
• Remark: K08F4.7 = Ce-GST-p24 Reporter gene fusion type not specified.
• Pattern: GFP signals originating from the fusion protein were detected along the whole worm, dominating in the muscle fibers of the longitudinal musculature and in the hypodermis. Significant expression was also observed in the cells surrounding the pharynx, but not in the pharynx itself. In contrast, L3-larvae showed expression of the Ce-GST-p24-GFP fusion protein in the isthmus and in the terminal bulbus of the pharynx. As in adults, the Ce-GST-p24-GFP fusion protein was expressed primarily in the muscles and the hypodermis. The Ce-GST-p24 seems to be stage-specifically expressed, since the GFP expression was stronger in larvae than in adults and totally lacking in embryos.

• Primary Identifier: Expr15758

• Primary Identifier: Expr11264

• Primary Identifier: Expr8083
• Remark: Picture: Fig. 1.
• Pattern: In dvIs19, GFP signals were constitutively observed in the body-wall muscle without acrylamide. Its GFP signal pattern was the same as that for MJCU017 upon exposure to acrylamide.

• Primary Identifier: Expr8018
• Remark: Picture: Figure 2K, 2k, 2L, 2l.
• Pattern: Not expressed without acrylamide. Control animals without acrylamide. No GFP signal was detected. Animal treated with 500 mg/l acrylamide. Whole body showed strong GFP signal.

• Primary Identifier: Expr12195
• Pattern: In the intestine the Pgst-4: GFP reporter was expressed at very low levels under normal conditions.

• Primary Identifier: Expr1011358
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1053
• Remark: Original chronogram file: chronogram.2114.xml
• Reporter Gene: [K08F4.7:gfp] transcriptional fusion.

• Primary Identifier: Expr1154026
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2030565
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2012328
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

5 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001752
• Start: 10142225
• End: 10143099
• Strand: 1

5 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 875

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00026561
• WBStrain00032514
• WBStrain00005111
• WBStrain00005102

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_10142062..10142224
• Length (nt): 163
• Chromosome Location: IV: 10142062-10142224
• Organism: Caenorhabditis elegans