WormMine: Gene WBGene00001794

• WormBase Gene ID: WBGene00001794
• Gene Name: gta-1
• Sequence Name: K04D7.3
• Brief Description: The gta-1 gene encodes an ortholog of the human gene GABAT, which when mutated leads to GABA-transaminase deficiency (OMIM:137150).
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable 4-aminobutyrate transaminase activity and pyridoxal phosphate binding activity. Predicted to be involved in gamma-aminobutyric acid catabolic process. Located in mitochondrion. Human ortholog(s) of this gene implicated in Alzheimer's disease; GABA aminotransferase deficiency; and Huntington's disease. Is an ortholog of human ABAT (4-aminobutyrate aminotransferase).
• Biotype: SO:0001217
• Genetic Position: IV :4.55759 ±0.000613
• Length (nt): 3206

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001794

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:K04D7.3a.1	K04D7.3a.1	1568	IV: 10180660-10183865
Transcript:K04D7.3b.1	K04D7.3b.1	1020	IV: 10182606-10183757

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:K04D7.3a	K04D7.3a	1452	IV: 10180668-10180707
CDS:K04D7.3b	K04D7.3b	1020	IV: 10182606-10182830

3 RNAi Result

• WBRNAi00049896
• WBRNAi00016589
• WBRNAi00033944

51 Allele

• gk964278
• gk964078
• gk964500
• gk962765
• gk963603
• gk366841
• gk839538
• gk787992
• gk850628
• gk456799
• gk536374
• gk608705
• gk608706
• gk457753
• gk383343
• gk897831
• gk544552
• gk462034
• gk333807
• ttTi25729
• gk783782
• gk874794
• gk870973
• gk531126
• WBVar01856709
• gk852975
• WBVar01856708
• gk504302
• gk336058
• ok517

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001794
• Start: 10180660
• End: 10183865
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

212 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2.	DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1.	WBPaper00046012:tdp-1(ok803)_upregulated
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
Bacteria infection: Photorhabdus luminescens	Genes down-regulated in animals infected with Photorhabdus luminescens compared to the E. coli OP50 control after 24h of infection.	MAANOVA and BRB-Array-Tools.	WBPaper00030985:Photorhabdus_luminescens_downregulated
	Transcripts that showed significantly increased expression in Y56A3A.22(cck200) and Y56A3A.22(cck201) animals comparing to wild type animals.	N.A.	WBPaper00061045:Y56A3A.22(cck200)_upregulated
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly decreased expression in vit-2(ac3); zcIs4, comparing to parenting strain SJ4005 [zcIs4].	Differential gene expression analysis was then performed on normalized samples. Genes exhibiting at least twofold change and a false-discovery rate (FDR) of 1% or less were considered differentially expressed.	WBPaper00051305:vit-2(ac3)_downregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:clk-1(qm30)_upregulated

10 Expression Patterns

• Primary Identifier: Expr1031056
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6322
• Remark: Strain: BC12926
• Reporter Gene: [gta-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAGAAATGTAACGGTGCTTTGA] 3' and primer B 5' [GCCAGTCTGGGAAGCATT] 3'.
• Pattern: Adult Expression: body wall muscle; Nervous System; head neurons; Larval Expression: body wall muscle; Nervous System; head neurons

• Primary Identifier: Expr6323
• Remark: Strain: BC12782
• Reporter Gene: [gta-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAGAAATGTAACGGTGCTTTGA] 3' and primer B 5' [GCCAGTCTGGGAAGCATT] 3'.
• Pattern: Adult Expression: body wall muscle; Nervous System; head neurons; unidentified cells; Larval Expression: body wall muscle; Nervous System; head neurons

• Primary Identifier: Expr9527
• Remark: Operon: CEOP4360
• Pattern: Adult Expression: body wall muscle; Nervous System; head neurons; unidentified cells. Larval Expression: body wall muscle; Nervous System; head neurons
• Subcellular Localization: Sub-cellular localization within the body wall muscle: Mitochondria

• Primary Identifier: Expr1021207
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1153602
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram1002
• Remark: Original chronogram file: chronogram.2060.xml
• Reporter Gene: [K04D7.3:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1850
• Remark: Original chronogram file: chronogram.77.xml
• Reporter Gene: [K04D7.3:gfp] transcriptional fusion.

• Primary Identifier: Expr2030577
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2012340
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

15 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001794
• Start: 10180660
• End: 10183865
• Strand: 1

15 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3206

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00031464
• WBStrain00002319
• WBStrain00002411

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_10180302..10180659
• Length (nt): 358
• Chromosome Location: IV: 10180302-10180659
• Organism: Caenorhabditis elegans