WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00001697 Gene Name  grd-8
Sequence Name  ? C37C3.4 Brief Description  grd-8 encodes a hedgehog-like protein, with an N-terminal signalsequence, a central low-complexity proline-rich domain, and a C-terminalGround domain; GRD-8 is expressed in larval intestine and neurons; thegrd-8 gene is directly bound by DAF-12 and requires DAF-12 for fulltranscription; GRD-8's Ground domain is predicted to form acysteine-crosslinked protein involved in intercellular signalling, andit has subtle similarity to the N-terminal Hedge domain of HEDGEHOGproteins; GRD-8 is weakly required for normal molting; GRD-8 is alsorequired for normal adult alae formation, growth to full size,locomotion, and male tail development; all of these requirements mayreflect common defects in cholesterol-dependent hedgehog-like signallingor in vesicle trafficking.
Organism  Caenorhabditis elegans Automated Description  Acts upstream of or within nematode male tail mating organ morphogenesis. Expressed in OLLL and OLLR.
Biotype  SO:0001217 Genetic Position  V :0.915324±
Length (nt)  ? 1826
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00001697

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C37C3.4.1 C37C3.4.1 1191   V: 7842528-7844353
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C37C3.4 C37C3.4 1122   V: 7842543-7842704

6 RNAi Result

WormBase ID
WBRNAi00042108
WBRNAi00077021
WBRNAi00076997
WBRNAi00011716
WBRNAi00029637
WBRNAi00076974

22 Allele

Public Name
gk963301
gk963553
gk964259
gk964351
gk963850
gk962860
gk563666
gk660064
gk930549
WBVar01460817
gk699574
gk461600
gk599412
gk729100
gk362861
gk918571
gk741006
gk363644
gk606550
gk818835
gk899591
gk730371

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00001697 7842528 7844353 1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

24 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:sre-33-ZK1025.1_8337
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:excretory-cell_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
  Genes with significantly increased expression in eat-2(ad465) treated with 2% DMSO for 72 hours, comparing to in N2 treated with 2% DMSO for 72 hours. Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes. WBPaper00048989:eat-2(ad465)_upregulated_in-DMSO
Heat shock: 34C 30min. Transcripts that showed significantly increased expression in L2 larva stage C. elegans animals after incubated in a 34C water bath for 30min. DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. WBPaper00058955:heatshock_upregulated_CE
  Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-2(e1370)_upregulated_neuron
  Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-16(mu86)_upregulated_neuron
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L2-larva_expressed
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
  Transcripts that showed significantly depleted expression in sensory neuron (labeled by iaIs25[Pgcy-37::GFP + unc-119(+)]) comparing to in whole worm. Fold change > 2, p-value < 0.05. WBPaper00060661:sensory-neuron_depleted
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_14
  Genes that showed significantly decreased experssion after 22.5 hours of treatment in 200nM delta7-dafachronic acid comparing with in ethanol vehicle control. To identify the differentially expressed genes, we applied Significance Analysis of Microarrays (SAM) analysis using the R package samr [46]. Genes with median false discovery <5% and fold changes >2.0 were considered differentially expressed. WBPaper00046548:dafachronic-acid_downregulated
  Transcripts that showed differential expression in dauer N2 vs dauer mir-34(gk437) animals at 20C. N.A. WBPaper00050488:N2_vs_mir-34(gk437)_regulated_dauer_20C
  Genes enriched in intestine. To identify genes that are significantly enriched by mRNA tagging, we first normalized the total amount of Cy3 and Cy5 signal to each other in each hybridization. We measured the ratio of the signals from the co-immunoprecipitated mRNA (Cy5) to total RNA in the cell extract (Cy3), and calculated the percentile rank for each gene relative to all genes in each hybridization. The mean percentile rank was determined from eight repeats of the mRNA-tagging experiment. Student's t-test was used to determine which genes showed a mean enrichment significantly greater than the median enrichment for all genes (P<0.001). WBPaper00026980:intestine_enriched
  Transcripts that showed significantly decreased expression in mex-1(or286) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:mex-1(or286)_downregulated
  Transcripts that showed significantly increased expression in the neurons of bcat-1(RNAi) animals at 5-days post L4 adult hermaphrodite stage, comparing to animals injected with empty vector. DESeq2. FDR < 0.05. WBPaper00060459:bcat-1(RNAi)_upregulated
  Transcripts that showed significantly decreased expression in drh-3(rrr2) comparing to in N2. edgeR, log2 fold change > 2 or < -2. WBPaper00053888:drh-3(rrr2)_downregulated
  Potental DAF-12 target genes identified by ChIP-chip analysis performed on strain ALF4 [daf-12 Affymetrix TAS software that computed for each probe estimates of fold enrichment (in linear scale) over hybridization with input DNA. At the same time, TAS calculated for each probe a p-value by applying a Wilcoxon signed rank test. A threshold of 2.5 was selected, which corresponds to probe intensities approximately 2.5 times stronger on the ChIP array than on the Input array. Additional TAS threshold parameters were MinRun=180 bp, MaxGap=300 bp. TAS analysis showed that the selected threshold of 2.5 corresponds approximately to a p-value of 0.01. WBPaper00040221:DAF-12_target_ALF4
  Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh6), triggered by the dafachronic acid (DA) growth hormone. Cluster 4 genes increased expression transiently during dauer commitment. Benjamini Hochberg corrected q-value < 0.01. WBPaper00053388:dauer_regulated_Cluster4
  Genes that showed decreased expression after exposure to 7.5uM CH3HgCl for 24 hours. Rosetta Resolver was used to identify differentially expressed genes using an error-weighted, 1-way ANOVA with a Bonferroni correction. A 2-fold change in expression, relative to untreated controls, and a p-value < 0.01 was required for a gene to qualify as significantly, differentially expressed. WBPaper00044316:CH3HgCl_7.5uM_downregulated
  Transcripts that showed significantly decreased expression in mex-3(eu149) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:mex-3(eu149)_downregulated
  Genes from N2 animals with significantly increased expression after 72 hours of treatment on growth media with 250uM allantoin in 2% DMSO. Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes. WBPaper00048989:N2_allantoin_upregulated
  Transcripts that showed significantly decreased expression in spn-4(tm291) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:spn-4(tm291)_downregulated

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr4434 Expressed in socket cells of IL or OLQ. Strongly expressed in OLLL and OLLR neurons.  
Strain: BC15238 [grd-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATGGCATGAAATACAAGACAAA] 3' and primer B 5' [AAGTGGAAGTAATGGCACGAA] 3'. Expr5458 Larval Expression: intestine; Nervous System; head neurons;  
    Expr1031013 Tiling arrays expression graphs  
    Expr2012238 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1010876 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Reporter gene fusion type not specified. This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).   Expr639 No expression.  
    Expr2030474 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1146109 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

1 GO Annotation

Annotation Extension Qualifier
  acts_upstream_of_or_within

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00001697 7842528 7844353 1

1 Ontology Annotations

Annotation Extension Qualifier
  acts_upstream_of_or_within

0 Regulates Expr Cluster

1 Sequence

Length
1826

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_7842391..7842527   137 V: 7842391-7842527 Caenorhabditis elegans