WormMine: Gene WBGene00001953

• WormBase Gene ID: WBGene00001953
• Gene Name: hlh-8
• Sequence Name: C02B8.4
• Brief Description: The hlh-8 gene encodes a helix-loop-helix protein required for normal muscle development, and hence for normal defecation and egg-laying.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Involved in mesodermal cell fate specification; positive regulation of transcription by RNA polymerase II; and vulval cell fate specification. Predicted to be located in nucleus. Expressed in several structures, including M.dla; M.dra; M.vla; body wall muscle cell from M lineage; and enteric muscle. Used to study Saethre-Chotzen syndrome. Human ortholog(s) of this gene implicated in several diseases, including Barber-Say syndrome; Sweeney-Cox syndrome; and synostosis (multiple). Is an ortholog of human TWIST2 (twist family bHLH transcription factor 2).
• Biotype: SO:0001217
• Genetic Position: X :-0.530654 ±0.011006
• Length (nt): 3895

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001953

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C02B8.4.1	C02B8.4.1	866	X: 8116457-8120340
Transcript:C02B8.4.2	C02B8.4.2	785	X: 8116635-8120351

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C02B8.4	C02B8.4	537	X: 8116638-8116739

14 RNAi Result

• WBRNAi00067074
• WBRNAi00039399
• WBRNAi00027156
• WBRNAi00009975
• WBRNAi00024447
• WBRNAi00024448
• WBRNAi00027769
• WBRNAi00063524
• WBRNAi00070618
• WBRNAi00112280
• WBRNAi00092851
• WBRNAi00063523
• WBRNAi00070619
• WBRNAi00114705

88 Allele

• gk964260
• gk962707
• gk964193
• gk964194
• gk963896
• tm10215
• gk963732
• WBVar01927536
• WBVar01927537
• WBVar01927538
• WBVar02065011
• WBVar01711101
• tm726
• gk483220
• WBVar01820412
• WBVar01820413
• ok1248
• n2170
• nr2061
• th11
• th12
• th13
• th14
• th15
• th16
• th17
• gk720070
• th18
• th19
• gk640788

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001953
• Start: 8116457
• End: 8120351
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

91 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point on the non pathogenic strain Bt407 compared to E. coli OP50.	Cuffdiff	WBPaper00060358:B.thuringiensis_non-pathogen_regulated_elt-2(RNAi)
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
	Transcripts that showed significantly decreased expression in pfd-6(gk493446); daf-2(e1370) comparing to in daf-2(e1370).	Limma version 3.24.15. Fold change < 0.67 (p < 0.05).	WBPaper00055827:pfd-6(gk493446)_downregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
heat-shock hlh-1	Genes enriched in HLH-1 heat shock dataset.	A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets.	WBPaper00031003:hlh_1_enriched
	Transcripts that showed significantly increased expression in spr-1(ok2144) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:spr-1(ok2144)_upregulated
	Genes that showed decreased expression after 1-methylnicotinamide (MNA) treatment.	Raw counts for the genes were analyzed using the R Statistical Computing Environment and the Bioconductor packages DESeq and edgeR. Both packages provide statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochberg's approach for controlling the false discovery rate (FDR). If both FDR values (by DESeq and edgeR) were smaller than p = 0.05, genes were assigned as differentially expressed.	WBPaper00044260:1-methylnicotinamide_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-2(e1370)_upregulated_neuron
	Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00066978:daf-16(mu86)_upregulated_neuron
	Transcripts that showed significantly lower expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:hmc_biased
	Top 300 transcripts enriched in head mesodermal cell according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:hmc
	Single-cell RNA-Seq cell group 110_0 expressed in coelomocyte.	scVI 0.6.0	WBPaper00065841:110_0

13 Expression Patterns

• Primary Identifier: Expr5104
• Remark: Also expressed in (comments from author) : There are two cells expressing GFP in the body. Strain: BC12188
• Reporter Gene: [hlh-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAGCTTTCAAAATCCCAAACA] 3' and primer B 5' [GCCACGATCTGTGAAAATCATA] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine; unidentified cells in body

• Primary Identifier: Marker68
• Remark: Picture: Figure 2C. Reporter gene fusion type not specified.
• Pattern: Marker for M cell.

• Primary Identifier: Expr606
• Remark: CeTwist means hlh-8 here. See Expr607 for the pattern of the same locus. This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: Immuno fluorescence staining with antisera to ceTwist indicated similar expression pattern to reporter fusion. CeTwist first detected in L1 in defecation-associated muscles and in small number of neuron-like cells in the head. In later larvae, CeTwist was detected in SMs and their descendants. Expression in M and its descendants prior to to the SM stage was detected with reporter fusion but not with antibody. Expression in mature coelomocytes was also only detected with reporter fusions.

• Primary Identifier: Expr607
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: 3-fold embryo staining first detected in M blast cell after it had finished its posterior migration. hlh-8::gfp detected after hatching in a set of rectum-associated cells that appeared to be defecation-associated muscles (this required full-length hlh-8 genomic fragment). During larval development hlh-8::gfp detected in M cell and all undifferentiated descendants of M. This expression was lost as cells differentiated into body wall or sex muscles. Expression was maintained in the two M derived coelomocytes throughout adult life. L2 expression was seen in all four non-M-derived embryonic coelomocytes. Expression was detected in embryonic coelomocytes after the birth of both postembryonic M-derived coelomocytes. Expression also observed in head cells, likely to be neuronal. hlh-8::lacZ fusion with addition 5' sequences showed reporter activity in coelomocytes. Expression in all these cells were nuclear localized both with gfp and lacZ.

• Primary Identifier: Expr1200166
• Pattern: Data from the TransgeneOme project

• Primary Identifier: Expr2030752
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2012513
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram608
• Remark: Original chronogram file: chronogram.1637.xml
• Reporter Gene: [C02B8.4:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1383
• Remark: Original chronogram file: chronogram.2626.xml
• Reporter Gene: [C02B8.4:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1353
• Remark: Original chronogram file: chronogram.2599.xml
• Reporter Gene: [C02B8.4:gfp] transcriptional fusion.

• Primary Identifier: Expr1143515
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram1332
• Remark: Original chronogram file: chronogram.2578.xml
• Reporter Gene: [C02B8.4:gfp] transcriptional fusion.

• Primary Identifier: Expr1026235
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

17 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001953
• Start: 8116457
• End: 8120351
• Strand: 1

17 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3895

1 Sequence Ontology Term

• Name: gene

7 Strains

• WBStrain00027640
• WBStrain00027639
• WBStrain00030584
• WBStrain00030588
• WBStrain00030587
• WBStrain00033322
• WBStrain00037705

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_8114763..8116456
• Length (nt): 1694
• Chromosome Location: X: 8114763-8116456
• Organism: Caenorhabditis elegans